Incidental Mutation 'R5609:5330417C22Rik'
ID437958
Institutional Source Beutler Lab
Gene Symbol 5330417C22Rik
Ensembl Gene ENSMUSG00000040412
Gene NameRIKEN cDNA 5330417C22 gene
Synonyms
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108455694-108536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108471415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 408 (I408F)
Ref Sequence ENSEMBL: ENSMUSP00000102237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048012] [ENSMUST00000106625] [ENSMUST00000106626] [ENSMUST00000185128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048012
AA Change: I356F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040128
Gene: ENSMUSG00000040412
AA Change: I356F

DomainStartEndE-ValueType
internal_repeat_1 3 212 1.11e-6 PROSPERO
internal_repeat_1 289 522 1.11e-6 PROSPERO
transmembrane domain 806 828 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106625
AA Change: I458F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102236
Gene: ENSMUSG00000040412
AA Change: I458F

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 310 8.31e-11 PROSPERO
internal_repeat_1 325 620 8.31e-11 PROSPERO
transmembrane domain 904 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106626
AA Change: I408F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102237
Gene: ENSMUSG00000040412
AA Change: I408F

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 178 2.5e-7 PROSPERO
internal_repeat_1 275 421 2.5e-7 PROSPERO
transmembrane domain 854 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148493
Predicted Effect probably benign
Transcript: ENSMUST00000185128
SMART Domains Protein: ENSMUSP00000138870
Gene: ENSMUSG00000040412

DomainStartEndE-ValueType
low complexity region 25 31 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Male homozygous mice are infertile. Microscopic analysis revealed defective spermatogenesis in the testis, and hypospermia and defective spermatozoa in the epididymides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in 5330417C22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:5330417C22Rik APN 3 108481312 missense possibly damaging 0.48
IGL02079:5330417C22Rik APN 3 108481359 missense possibly damaging 0.91
IGL02268:5330417C22Rik APN 3 108467797 missense probably benign 0.00
IGL02869:5330417C22Rik APN 3 108472866 missense probably benign 0.34
IGL02891:5330417C22Rik APN 3 108464392 missense probably benign 0.03
IGL03088:5330417C22Rik APN 3 108536358 missense probably damaging 1.00
IGL03345:5330417C22Rik APN 3 108492016 missense possibly damaging 0.68
IGL03398:5330417C22Rik APN 3 108461221 missense possibly damaging 0.94
IGL03138:5330417C22Rik UTSW 3 108471993 missense probably benign 0.08
R0325:5330417C22Rik UTSW 3 108461251 missense probably damaging 1.00
R0730:5330417C22Rik UTSW 3 108469535 missense probably benign 0.00
R0844:5330417C22Rik UTSW 3 108480963 splice site probably benign
R1646:5330417C22Rik UTSW 3 108462990 missense probably damaging 1.00
R1666:5330417C22Rik UTSW 3 108469997 missense probably benign 0.01
R1726:5330417C22Rik UTSW 3 108467868 missense possibly damaging 0.67
R2202:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2203:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2204:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2205:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2249:5330417C22Rik UTSW 3 108471410 nonsense probably null
R2443:5330417C22Rik UTSW 3 108481349 missense probably damaging 1.00
R3965:5330417C22Rik UTSW 3 108458449 missense probably damaging 1.00
R4171:5330417C22Rik UTSW 3 108460943 missense probably benign 0.30
R4785:5330417C22Rik UTSW 3 108458227 utr 3 prime probably benign
R4810:5330417C22Rik UTSW 3 108470011 splice site probably benign
R4862:5330417C22Rik UTSW 3 108467833 missense probably benign
R4923:5330417C22Rik UTSW 3 108471968 critical splice donor site probably null
R5040:5330417C22Rik UTSW 3 108475001 missense probably damaging 1.00
R5153:5330417C22Rik UTSW 3 108472747 missense possibly damaging 0.75
R5405:5330417C22Rik UTSW 3 108467786 nonsense probably null
R5663:5330417C22Rik UTSW 3 108492083 missense probably benign 0.00
R6194:5330417C22Rik UTSW 3 108465779 missense probably benign 0.05
R6303:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6304:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6381:5330417C22Rik UTSW 3 108481814 missense possibly damaging 0.52
R6676:5330417C22Rik UTSW 3 108469915 missense probably damaging 1.00
R6852:5330417C22Rik UTSW 3 108482338 missense probably damaging 1.00
R7221:5330417C22Rik UTSW 3 108475001 missense possibly damaging 0.92
R7320:5330417C22Rik UTSW 3 108464303 nonsense probably null
X0022:5330417C22Rik UTSW 3 108459746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACATGGCCACTGTTTGTG -3'
(R):5'- AAGGATTGCCACAGATCTGG -3'

Sequencing Primer
(F):5'- GTGTCCCTCTGGATTGATTCAACG -3'
(R):5'- ACAGATCTGGCCAGCCC -3'
Posted On2016-10-26