Incidental Mutation 'R5609:Ago1'
ID437959
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 126461037 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 127 (K127N)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097888
AA Change: K127N

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: K127N

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000127800
AA Change: K49N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149425
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 unclassified probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTTTTACCAACACTGTCGCTTAG -3'
(R):5'- AGAAGCACTGGGGCATCATC -3'

Sequencing Primer
(F):5'- CCAACACTGTCGCTTAGATAATAAC -3'
(R):5'- AAGTACACTGTAGCTGTCTTCAGGC -3'
Posted On2016-10-26