Incidental Mutation 'R5609:Daglb'
ID437961
Institutional Source Beutler Lab
Gene Symbol Daglb
Ensembl Gene ENSMUSG00000039206
Gene Namediacylglycerol lipase, beta
Synonyms
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5609 (G1)
Quality Score190
Status Not validated
Chromosome5
Chromosomal Location143464584-143505942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143478519 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 262 (T262S)
Ref Sequence ENSEMBL: ENSMUSP00000043088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045593]
Predicted Effect probably benign
Transcript: ENSMUST00000045593
AA Change: T262S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043088
Gene: ENSMUSG00000039206
AA Change: T262S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Pfam:Lipase_3 370 505 1.1e-18 PFAM
Predicted Effect not run
Transcript: ENSMUST00000145651
AA Change: T179S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199577
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations have a reduction in endocannabinoids in the brain and a decrease in adult neuronal proliferation in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Daglb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03046:Daglb UTSW 5 143501193 missense probably damaging 1.00
PIT4802001:Daglb UTSW 5 143503048 missense probably benign 0.04
R0145:Daglb UTSW 5 143474608 splice site probably benign
R0348:Daglb UTSW 5 143487196 missense probably benign 0.01
R0504:Daglb UTSW 5 143494197 missense probably benign
R1695:Daglb UTSW 5 143494606 missense probably benign 0.02
R4043:Daglb UTSW 5 143487151 missense possibly damaging 0.92
R4358:Daglb UTSW 5 143473134 intron probably benign
R4666:Daglb UTSW 5 143503349 missense probably damaging 0.99
R6062:Daglb UTSW 5 143494603 missense probably benign 0.07
R6153:Daglb UTSW 5 143503341 missense probably benign 0.00
R6251:Daglb UTSW 5 143489934 missense probably damaging 1.00
R6475:Daglb UTSW 5 143481651 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCAACTGGATGCTAAGGGC -3'
(R):5'- TCAGTCCCAAGCGACTAAAATTG -3'

Sequencing Primer
(F):5'- CTTCCCGGGCAGTCTGATG -3'
(R):5'- ACACAGGGTCTACTTCTAGCC -3'
Posted On2016-10-26