Incidental Mutation 'R5609:Eif3k'
ID437966
Institutional Source Beutler Lab
Gene Symbol Eif3k
Ensembl Gene ENSMUSG00000053565
Gene Nameeukaryotic translation initiation factor 3, subunit K
SynonymsEif3s12, eIF3K, 1200009C21Rik
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28971372-28981864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28981708 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 9 (A9S)
Ref Sequence ENSEMBL: ENSMUSP00000147214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066070] [ENSMUST00000085835] [ENSMUST00000207185] [ENSMUST00000207683] [ENSMUST00000208227] [ENSMUST00000208616] [ENSMUST00000208707]
Predicted Effect probably benign
Transcript: ENSMUST00000066070
AA Change: A9S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000066038
Gene: ENSMUSG00000053565
AA Change: A9S

DomainStartEndE-ValueType
Pfam:CSN8_PSD8_EIF3K 61 200 1.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085835
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207185
Predicted Effect probably benign
Transcript: ENSMUST00000207683
AA Change: A9S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207762
Predicted Effect probably benign
Transcript: ENSMUST00000208227
Predicted Effect probably benign
Transcript: ENSMUST00000208616
AA Change: A9S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000208707
AA Change: A9S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex (Mayeur et al., 2003 [PubMed 14519125]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Eif3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Eif3k APN 7 28974676 splice site probably benign
IGL03049:Eif3k APN 7 28971433 missense possibly damaging 0.72
R1833:Eif3k UTSW 7 28971427 missense probably benign 0.03
R4698:Eif3k UTSW 7 28972544 missense possibly damaging 0.62
R6866:Eif3k UTSW 7 28977226 missense possibly damaging 0.85
Z1088:Eif3k UTSW 7 28974599 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACTATGTAGGATGGTCCACAAGG -3'
(R):5'- TGAAAGCGCCTTTCCCTTTG -3'

Sequencing Primer
(F):5'- CTAAAAGACACCGGGAGTCTGTG -3'
(R):5'- CCCTTTGCCTTCCTTGTAGG -3'
Posted On2016-10-26