Incidental Mutation 'R5609:Gli3'
ID437987
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15548453 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 60 (M60L)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065] [ENSMUST00000141194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: M60L

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: M60L

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130065
AA Change: M60L

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: M60L

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130535
Predicted Effect probably benign
Transcript: ENSMUST00000141194
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCAAGTATCCCGCCACAG -3'
(R):5'- TGAGGCTCCATGTAGCCATTC -3'

Sequencing Primer
(F):5'- GTATCCCGCCACAGGTATGAATTTAC -3'
(R):5'- ATGTAGCCATTCCGGGGATC -3'
Posted On2016-10-26