Mutagenetix > Incidental Mutation

Incidental Mutation 'R5611:Pikfyve'

437998

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

043273-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5611 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 65295247 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1459 (N1459K)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: N1459K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: N1459K

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097707
AA Change: N1504K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: N1504K

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	G	C	11: 48,910,828 (GRCm39)	T535R	possibly damaging	Het
Adam34	A	T	8: 44,104,749 (GRCm39)	F299I	probably benign	Het
Adamts20	A	G	15: 94,171,161 (GRCm39)	M1854T	possibly damaging	Het
Adrm1b	G	A	3: 92,335,758 (GRCm39)	P315S	probably damaging	Het
Apbb1	A	G	7: 105,208,690 (GRCm39)	V581A	probably damaging	Het
Apol6	T	A	15: 76,935,240 (GRCm39)		probably null	Het
Arhgef37	T	C	18: 61,640,334 (GRCm39)	T242A	probably benign	Het
Asxl2	T	C	12: 3,534,598 (GRCm39)	V265A	probably damaging	Het
Bicd1	A	T	6: 149,414,954 (GRCm39)	R556*	probably null	Het
C2	A	G	17: 35,091,360 (GRCm39)	I101T	probably damaging	Het
Cd22	T	A	7: 30,577,575 (GRCm39)		probably benign	Het
Cd33	T	C	7: 43,181,542 (GRCm39)	H206R	probably damaging	Het
Cd5l	G	A	3: 87,275,082 (GRCm39)	G207D	possibly damaging	Het
Chrd	A	T	16: 20,557,724 (GRCm39)	D774V	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 105,036,102 (GRCm39)		probably benign	Het
Csn1s1	A	T	5: 87,825,503 (GRCm39)		probably null	Het
Dpyd	G	A	3: 118,987,942 (GRCm39)	V704I	probably benign	Het
Dscc1	C	A	15: 54,945,569 (GRCm39)	Q312H	probably benign	Het
Dysf	A	T	6: 84,041,860 (GRCm39)	T154S	probably damaging	Het
Foxi2	T	C	7: 135,013,433 (GRCm39)	V221A	probably benign	Het
Gabbr2	A	T	4: 46,804,105 (GRCm39)	I250N	probably damaging	Het
Gfap	T	A	11: 102,787,895 (GRCm39)	T17S	probably benign	Het
Hcrtr2	A	G	9: 76,230,596 (GRCm39)	V64A	probably damaging	Het
Igkv4-86	A	G	6: 68,887,659 (GRCm39)	S27P	probably damaging	Het
Kalrn	G	T	16: 33,996,150 (GRCm39)	F903L	probably damaging	Het
Lrrc31	A	G	3: 30,745,304 (GRCm39)		probably null	Het
Mlh3	T	C	12: 85,314,219 (GRCm39)	T656A	probably benign	Het
Mss51	G	T	14: 20,533,174 (GRCm39)	S432R	possibly damaging	Het
Mzf1	A	G	7: 12,778,554 (GRCm39)		probably benign	Het
Nop58	T	A	1: 59,749,672 (GRCm39)		probably benign	Het
Or10al5	A	T	17: 38,062,975 (GRCm39)	I77F	possibly damaging	Het
Otogl	T	C	10: 107,622,630 (GRCm39)	E1652G	probably damaging	Het
Pkn3	G	A	2: 29,969,673 (GRCm39)	G61D	probably damaging	Het
Plekha4	T	C	7: 45,203,065 (GRCm39)	S581P	probably benign	Het
Ppm1g	A	G	5: 31,363,441 (GRCm39)	F256L	probably damaging	Het
Proser1	A	G	3: 53,386,296 (GRCm39)	N726S	probably benign	Het
Rapgef1	A	G	2: 29,592,448 (GRCm39)	D480G	probably damaging	Het
Reln	G	A	5: 22,244,663 (GRCm39)	Q772*	probably null	Het
Sh3gl2	T	C	4: 85,273,568 (GRCm39)	V40A	probably benign	Het
Slc22a23	G	A	13: 34,489,222 (GRCm39)	T221I	probably benign	Het
Slc22a28	T	A	19: 8,040,698 (GRCm39)	T518S	probably damaging	Het
Slc4a1ap	A	G	5: 31,711,173 (GRCm39)		probably benign	Het
St8sia4	T	C	1: 95,555,409 (GRCm39)	D207G	probably damaging	Het
Syde1	T	A	10: 78,421,725 (GRCm39)	T609S	probably benign	Het
Tbc1d5	A	G	17: 51,042,995 (GRCm39)	I831T	probably damaging	Het
Tle4	T	C	19: 14,427,159 (GRCm39)	D754G	probably damaging	Het
Ttn	C	T	2: 76,562,869 (GRCm39)	W26949*	probably null	Het
Vmn1r222	A	C	13: 23,416,743 (GRCm39)	S157A	probably damaging	Het
Vmn1r51	T	A	6: 90,106,692 (GRCm39)	L203M	probably benign	Het
Vmn1r6	T	C	6: 56,979,362 (GRCm39)	L8P	probably damaging	Het
Vmn2r103	A	G	17: 20,013,904 (GRCm39)	D232G	probably damaging	Het
Vmn2r17	T	A	5: 109,576,030 (GRCm39)	D300E	probably damaging	Het
Vmn2r66	T	A	7: 84,654,951 (GRCm39)	K453*	probably null	Het
Vps13a	A	T	19: 16,702,936 (GRCm39)	D672E	probably damaging	Het
Vps54	A	G	11: 21,261,130 (GRCm39)	N599S	possibly damaging	Het
Zc3h13	A	T	14: 75,568,348 (GRCm39)	N1214Y	probably benign	Het
Zc3h18	T	G	8: 123,135,109 (GRCm39)		probably null	Het
Zfp51	A	G	17: 21,684,354 (GRCm39)	E323G	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,295,231 (GRCm39)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,302,136 (GRCm39)	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65,304,443 (GRCm39)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,302,112 (GRCm39)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,291,689 (GRCm39)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTACCAAACTTGTTTCTGTTGC -3'
(R):5'- CTTGAAACAGCAATGAGGGC -3'

Sequencing Primer
(F):5'- AACTTGTTTCTGTTGCTTTCCAGATG -3'
(R):5'- ACAGCAATGAGGGCTATTTCC -3'

Posted On

2016-10-26