Incidental Mutation 'R5611:Lrrc31'
ID438007
Institutional Source Beutler Lab
Gene Symbol Lrrc31
Ensembl Gene ENSMUSG00000074653
Gene Nameleucine rich repeat containing 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location30679058-30699843 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 30691155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108263] [ENSMUST00000126658]
Predicted Effect probably null
Transcript: ENSMUST00000108263
SMART Domains Protein: ENSMUSP00000103898
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.5e-2 SMART
Blast:LRR 148 175 1e-8 BLAST
LRR 176 203 2.6e-1 SMART
LRR 204 231 6.7e-2 SMART
LRR 260 287 1e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126658
SMART Domains Protein: ENSMUSP00000120802
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.4e-2 SMART
Blast:LRR 148 175 2e-8 BLAST
LRR 176 203 2.5e-1 SMART
LRR 204 231 6.5e-2 SMART
LRR 260 287 9.9e-2 SMART
Pfam:LRR_6 288 307 8.2e-1 PFAM
LRR 372 399 8e-3 SMART
LRR 402 430 2.7e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133653
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Lrrc31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03110:Lrrc31 APN 3 30679266 missense probably benign 0.04
R0285:Lrrc31 UTSW 3 30684948 missense probably benign 0.02
R0348:Lrrc31 UTSW 3 30689228 missense probably benign 0.14
R0418:Lrrc31 UTSW 3 30689234 missense probably damaging 1.00
R0453:Lrrc31 UTSW 3 30687525 missense probably damaging 1.00
R0613:Lrrc31 UTSW 3 30685035 splice site probably benign
R2243:Lrrc31 UTSW 3 30685030 splice site probably benign
R2248:Lrrc31 UTSW 3 30689901 missense possibly damaging 0.95
R4093:Lrrc31 UTSW 3 30695522 missense probably damaging 1.00
R4781:Lrrc31 UTSW 3 30687377 intron probably benign
R4805:Lrrc31 UTSW 3 30691297 nonsense probably null
R4835:Lrrc31 UTSW 3 30679157 missense probably damaging 0.97
R4893:Lrrc31 UTSW 3 30679297 missense probably benign 0.02
R4936:Lrrc31 UTSW 3 30689268 missense probably damaging 1.00
R5063:Lrrc31 UTSW 3 30689936 missense possibly damaging 0.78
R5135:Lrrc31 UTSW 3 30684890 nonsense probably null
R5527:Lrrc31 UTSW 3 30691228 missense probably damaging 1.00
R5607:Lrrc31 UTSW 3 30689845 splice site probably null
R5608:Lrrc31 UTSW 3 30689845 splice site probably null
R5865:Lrrc31 UTSW 3 30679140 missense probably benign 0.01
R6001:Lrrc31 UTSW 3 30691169 missense possibly damaging 0.68
X0027:Lrrc31 UTSW 3 30689279 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCCCAGTTGTGCACATAAAC -3'
(R):5'- ACACACAGGTCTGCATCCTC -3'

Sequencing Primer
(F):5'- AATAACCTCTAGTTTGGTCCTTCAGG -3'
(R):5'- ACACAGGTCTGCATCCTCTTCTG -3'
Posted On2016-10-26