Incidental Mutation 'R5611:Ppm1g'
ID438015
Institutional Source Beutler Lab
Gene Symbol Ppm1g
Ensembl Gene ENSMUSG00000029147
Gene Nameprotein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
SynonymsFin13
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31202664-31220687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31206097 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 256 (F256L)
Ref Sequence ENSEMBL: ENSMUSP00000031032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031032] [ENSMUST00000031562] [ENSMUST00000114590] [ENSMUST00000201231] [ENSMUST00000201407] [ENSMUST00000202294] [ENSMUST00000202929]
Predicted Effect probably damaging
Transcript: ENSMUST00000031032
AA Change: F256L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031032
Gene: ENSMUSG00000029147
AA Change: F256L

DomainStartEndE-ValueType
PP2Cc 15 500 9.7e-103 SMART
PP2C_SIG 219 502 1.05e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031562
SMART Domains Protein: ENSMUSP00000031562
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
low complexity region 100 117 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
ZnF_C2H2 148 170 1.33e-1 SMART
ZnF_C2H2 176 198 2.86e-1 SMART
ZnF_C2H2 204 226 1.06e-4 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C2H2 358 380 1.03e-2 SMART
ZnF_C2H2 386 408 5.42e-2 SMART
ZnF_C2H2 414 436 2.91e-2 SMART
ZnF_C2H2 442 464 1.38e-3 SMART
ZnF_C2H2 470 492 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114590
SMART Domains Protein: ENSMUSP00000110238
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 146 N/A INTRINSIC
ZnF_C2H2 150 172 1.33e-1 SMART
ZnF_C2H2 178 200 2.86e-1 SMART
ZnF_C2H2 206 228 1.06e-4 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
ZnF_C2H2 360 382 1.03e-2 SMART
ZnF_C2H2 388 410 5.42e-2 SMART
ZnF_C2H2 416 438 2.91e-2 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
ZnF_C2H2 472 494 5.06e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200778
AA Change: F197L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200853
Predicted Effect probably benign
Transcript: ENSMUST00000201231
SMART Domains Protein: ENSMUSP00000144172
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201407
AA Change: F154L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144556
Gene: ENSMUSG00000029147
AA Change: F154L

DomainStartEndE-ValueType
Blast:PP2Cc 1 155 4e-87 BLAST
low complexity region 156 173 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202294
AA Change: F149L
SMART Domains Protein: ENSMUSP00000144644
Gene: ENSMUSG00000029147
AA Change: F149L

DomainStartEndE-ValueType
PP2Cc 15 393 6.6e-105 SMART
PP2C_SIG 38 395 3.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202402
Predicted Effect probably benign
Transcript: ENSMUST00000202929
SMART Domains Protein: ENSMUSP00000143817
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. Studies of a similar gene in mice suggested a role of this phosphatase in regulating cell cycle progression. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display perinatal lethality. Mice heterozygous for a targeted mutation display a decrease in prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Ppm1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Ppm1g APN 5 31208081 missense probably damaging 1.00
R0843:Ppm1g UTSW 5 31207551 splice site probably benign
R1483:Ppm1g UTSW 5 31203121 missense probably benign 0.45
R1750:Ppm1g UTSW 5 31206216 missense probably damaging 1.00
R5776:Ppm1g UTSW 5 31205110 missense probably benign 0.01
R6274:Ppm1g UTSW 5 31206406 missense probably damaging 0.99
R6450:Ppm1g UTSW 5 31203124 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAACCTCGAATACCTGAGTCTTG -3'
(R):5'- ATTGGGACAGGCGATGAACC -3'

Sequencing Primer
(F):5'- CAATTAGGCGCTAGCTGTTAAG -3'
(R):5'- TGGACCTGAGGACCCATCTAG -3'
Posted On2016-10-26