Incidental Mutation 'R5611:Zc3h18'
ID438033
Institutional Source Beutler Lab
Gene Symbol Zc3h18
Ensembl Gene ENSMUSG00000017478
Gene Namezinc finger CCCH-type containing 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122376609-122417360 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 122408370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017622] [ENSMUST00000093073] [ENSMUST00000127664] [ENSMUST00000176629]
Predicted Effect probably null
Transcript: ENSMUST00000017622
SMART Domains Protein: ENSMUSP00000017622
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 3e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 705 748 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
low complexity region 794 828 N/A INTRINSIC
low complexity region 871 887 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
coiled coil region 940 968 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093073
SMART Domains Protein: ENSMUSP00000090761
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
ZnF_C3H1 215 240 2.57e-3 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 285 292 N/A INTRINSIC
coiled coil region 394 460 N/A INTRINSIC
low complexity region 528 616 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
low complexity region 665 679 N/A INTRINSIC
low complexity region 681 724 N/A INTRINSIC
low complexity region 732 746 N/A INTRINSIC
low complexity region 770 804 N/A INTRINSIC
low complexity region 847 863 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
coiled coil region 916 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175819
SMART Domains Protein: ENSMUSP00000135055
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 3 34 N/A INTRINSIC
low complexity region 67 133 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176629
SMART Domains Protein: ENSMUSP00000134743
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 6e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 772 806 N/A INTRINSIC
low complexity region 849 865 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
coiled coil region 918 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177049
SMART Domains Protein: ENSMUSP00000135014
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 39 82 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 128 162 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177195
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Zc3h18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Zc3h18 APN 8 122386852 unclassified probably benign
IGL01160:Zc3h18 APN 8 122408250 unclassified probably benign
IGL01472:Zc3h18 APN 8 122416657 unclassified probably benign
R1525:Zc3h18 UTSW 8 122413938 missense probably benign 0.34
R1996:Zc3h18 UTSW 8 122407387 unclassified probably benign
R2351:Zc3h18 UTSW 8 122403187 nonsense probably null
R2398:Zc3h18 UTSW 8 122413866 intron probably benign
R2516:Zc3h18 UTSW 8 122403165 intron probably benign
R4435:Zc3h18 UTSW 8 122413952 critical splice donor site probably null
R4734:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4749:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4885:Zc3h18 UTSW 8 122401706 intron probably benign
R4952:Zc3h18 UTSW 8 122410900 unclassified probably benign
R5001:Zc3h18 UTSW 8 122383520 missense probably damaging 1.00
R5098:Zc3h18 UTSW 8 122386869 missense probably damaging 1.00
R5172:Zc3h18 UTSW 8 122407420 unclassified probably benign
R5213:Zc3h18 UTSW 8 122383649 missense probably damaging 1.00
R5337:Zc3h18 UTSW 8 122386902 missense probably damaging 1.00
R5558:Zc3h18 UTSW 8 122386920 missense probably damaging 1.00
R6080:Zc3h18 UTSW 8 122416544 unclassified probably benign
R6315:Zc3h18 UTSW 8 122383865 missense probably benign 0.28
R6349:Zc3h18 UTSW 8 122408286 unclassified probably benign
R6753:Zc3h18 UTSW 8 122383857 unclassified probably benign
V1024:Zc3h18 UTSW 8 122383857 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGCTGCAGGAGTAAAC -3'
(R):5'- TGGGCTGGACACTGTACATTC -3'

Sequencing Primer
(F):5'- GGAGTAAACGAACGCCACCTTG -3'
(R):5'- GGCTGGACACTGTACATTCCTACC -3'
Posted On2016-10-26