Incidental Mutation 'R5611:Zc3h13'
ID438045
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Namezinc finger CCCH type containing 13
Synonyms4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618
MMRRC Submission
Accession Numbers

Genbank: NM_026083

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75284373-75344426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75330908 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1214 (N1214Y)
Ref Sequence ENSEMBL: ENSMUSP00000022577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
Predicted Effect probably benign
Transcript: ENSMUST00000022577
AA Change: N1214Y

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: N1214Y

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227049
AA Change: N1214Y
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75330147 missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75335999 missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75309723 missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75343769 utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75330347 missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75331766 missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75293941 missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75293976 missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75316039 missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75323603 small insertion probably benign
FR4304:Zc3h13 UTSW 14 75323610 small insertion probably benign
FR4340:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4449:Zc3h13 UTSW 14 75323601 nonsense probably null
FR4548:Zc3h13 UTSW 14 75323599 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323597 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323598 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323596 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323599 small insertion probably benign
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75323254 missense unknown
R0374:Zc3h13 UTSW 14 75308965 missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75323482 missense unknown
R0408:Zc3h13 UTSW 14 75292186 nonsense probably null
R0967:Zc3h13 UTSW 14 75343739 missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75330549 missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75315984 missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75337483 nonsense probably null
R2021:Zc3h13 UTSW 14 75330195 missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75332147 missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75308940 nonsense probably null
R3745:Zc3h13 UTSW 14 75330661 missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75329738 missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75327601 missense unknown
R4799:Zc3h13 UTSW 14 75339423 missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75339396 missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75336009 missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75343619 missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75331247 missense probably damaging 1.00
R5687:Zc3h13 UTSW 14 75331960 nonsense probably null
R5726:Zc3h13 UTSW 14 75330829 missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75328132 missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75330709 missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75337409 missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75343736 missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75330423 missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75308915 missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75323558 small deletion probably benign
R6598:Zc3h13 UTSW 14 75332183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCCTTTAGTGACTGGTCTG -3'
(R):5'- TCATTAGATGGGGAGCGTAGGC -3'

Sequencing Primer
(F):5'- ACTGGTCTGATGAGGATGTGCC -3'
(R):5'- CGTAGGCGACCAGAGGTGTG -3'
Posted On2016-10-26