Incidental Mutation 'R5611:Apol6'
ID438047
Institutional Source Beutler Lab
Gene Symbol Apol6
Ensembl Gene ENSMUSG00000033576
Gene Nameapolipoprotein L 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77044729-77057106 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 77051040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127957] [ENSMUST00000129468] [ENSMUST00000142405] [ENSMUST00000149569] [ENSMUST00000152949] [ENSMUST00000166179] [ENSMUST00000229423]
Predicted Effect probably damaging
Transcript: ENSMUST00000127957
AA Change: Y170N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576
AA Change: Y170N

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139304
Predicted Effect probably benign
Transcript: ENSMUST00000142405
SMART Domains Protein: ENSMUSP00000117135
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148197
Predicted Effect probably damaging
Transcript: ENSMUST00000149569
AA Change: Y170N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576
AA Change: Y170N

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152949
AA Change: Y170N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576
AA Change: Y170N

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166179
SMART Domains Protein: ENSMUSP00000128399
Gene: ENSMUSG00000018893

DomainStartEndE-ValueType
Pfam:Globin 7 113 1.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229423
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Apol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Apol6 APN 15 77050716 missense probably damaging 1.00
IGL01788:Apol6 APN 15 77051016 missense possibly damaging 0.81
FR4304:Apol6 UTSW 15 77051436 frame shift probably null
FR4449:Apol6 UTSW 15 77051443 nonsense probably null
FR4548:Apol6 UTSW 15 77051445 frame shift probably null
FR4589:Apol6 UTSW 15 77051438 frame shift probably null
FR4737:Apol6 UTSW 15 77051442 frame shift probably null
R0350:Apol6 UTSW 15 77050947 nonsense probably null
R1167:Apol6 UTSW 15 77047108 nonsense probably null
R1906:Apol6 UTSW 15 77050860 missense probably damaging 0.99
R1996:Apol6 UTSW 15 77050756 missense probably benign 0.28
R2097:Apol6 UTSW 15 77047133 critical splice donor site probably null
R5980:Apol6 UTSW 15 77051019 missense possibly damaging 0.66
R6191:Apol6 UTSW 15 77055898 missense probably benign 0.00
R6300:Apol6 UTSW 15 77051271 missense probably benign 0.01
R6519:Apol6 UTSW 15 77051276 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCTACAACAACTGCAGG -3'
(R):5'- CAAGCTCTGTTGGGTTTGCC -3'

Sequencing Primer
(F):5'- CCTCACTGCTGTTGGGCATG -3'
(R):5'- CCCAGAGAGTATATATGTCCTGGC -3'
Posted On2016-10-26