Mutagenetix > Incidental Mutations

Incidental Mutation 'R5611:Adamts20'

438048

Institutional Source

Beutler Lab

Gene Symbol

Adamts20

Ensembl Gene

ENSMUSG00000022449

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20

Synonyms

ADAMTS-20, bt

MMRRC Submission

Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene?

Possibly non essential (E-score: 0.265) question?

Stock #

R5611 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94270163-94465418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94273280 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1854 (M1854T)

Ref Sequence

ENSEMBL: ENSMUSP00000036330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035342]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035342
AA Change: M1854T

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: M1854T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	186	1.4e-30	PFAM
Pfam:Reprolysin_5	253	445	3.6e-13	PFAM
Pfam:Reprolysin_4	253	460	1.1e-7	PFAM
Pfam:Reprolysin	255	464	1.5e-26	PFAM
Pfam:Reprolysin_2	272	454	1.8e-10	PFAM
Pfam:Reprolysin_3	276	410	5.8e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2.6e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART
TSP1	1416	1470	1.69e-2	SMART
TSP1	1471	1526	2.3e0	SMART
TSP1	1530	1579	1.23e0	SMART
TSP1	1653	1706	5.27e-4	SMART
Pfam:GON	1708	1905	5.8e-80	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	G	C	11: 49,020,001	T535R	possibly damaging	Het
Adam34	A	T	8: 43,651,712	F299I	probably benign	Het
Apbb1	A	G	7: 105,559,483	V581A	probably damaging	Het
Apol6	T	A	15: 77,051,040		probably null	Het
Arhgef37	T	C	18: 61,507,263	T242A	probably benign	Het
Asxl2	T	C	12: 3,484,598	V265A	probably damaging	Het
Bicd1	A	T	6: 149,513,456	R556*	probably null	Het
C2	A	G	17: 34,872,384	I101T	probably damaging	Het
Cd22	T	A	7: 30,878,150		probably benign	Het
Cd33	T	C	7: 43,532,118	H206R	probably damaging	Het
Cd5l	G	A	3: 87,367,775	G207D	possibly damaging	Het
Chrd	A	T	16: 20,738,974	D774V	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Csn1s1	A	T	5: 87,677,644		probably null	Het
Dpyd	G	A	3: 119,194,293	V704I	probably benign	Het
Dscc1	C	A	15: 55,082,173	Q312H	probably benign	Het
Dysf	A	T	6: 84,064,878	T154S	probably damaging	Het
Foxi2	T	C	7: 135,411,704	V221A	probably benign	Het
Gabbr2	A	T	4: 46,804,105	I250N	probably damaging	Het
Gfap	T	A	11: 102,897,069	T17S	probably benign	Het
Gm9774	G	A	3: 92,428,451	P315S	probably damaging	Het
Hcrtr2	A	G	9: 76,323,314	V64A	probably damaging	Het
Igkv4-86	A	G	6: 68,910,675	S27P	probably damaging	Het
Kalrn	G	T	16: 34,175,780	F903L	probably damaging	Het
Lrrc31	A	G	3: 30,691,155		probably null	Het
Mlh3	T	C	12: 85,267,445	T656A	probably benign	Het
Mss51	G	T	14: 20,483,106	S432R	possibly damaging	Het
Mzf1	A	G	7: 13,044,627		probably benign	Het
Nop58	T	A	1: 59,710,513		probably benign	Het
Olfr121	A	T	17: 37,752,084	I77F	possibly damaging	Het
Otogl	T	C	10: 107,786,769	E1652G	probably damaging	Het
Pikfyve	C	A	1: 65,256,088	N1459K	probably damaging	Het
Pkn3	G	A	2: 30,079,661	G61D	probably damaging	Het
Plekha4	T	C	7: 45,553,641	S581P	probably benign	Het
Ppm1g	A	G	5: 31,206,097	F256L	probably damaging	Het
Proser1	A	G	3: 53,478,875	N726S	probably benign	Het
Rapgef1	A	G	2: 29,702,436	D480G	probably damaging	Het
Reln	G	A	5: 22,039,665	Q772*	probably null	Het
Sh3gl2	T	C	4: 85,355,331	V40A	probably benign	Het
Slc22a23	G	A	13: 34,305,239	T221I	probably benign	Het
Slc22a28	T	A	19: 8,063,333	T518S	probably damaging	Het
Slc4a1ap	A	G	5: 31,553,829		probably benign	Het
St8sia4	T	C	1: 95,627,684	D207G	probably damaging	Het
Syde1	T	A	10: 78,585,891	T609S	probably benign	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tle4	T	C	19: 14,449,795	D754G	probably damaging	Het
Ttn	C	T	2: 76,732,525	W26949*	probably null	Het
Vmn1r222	A	C	13: 23,232,573	S157A	probably damaging	Het
Vmn1r51	T	A	6: 90,129,710	L203M	probably benign	Het
Vmn1r6	T	C	6: 57,002,377	L8P	probably damaging	Het
Vmn2r103	A	G	17: 19,793,642	D232G	probably damaging	Het
Vmn2r17	T	A	5: 109,428,164	D300E	probably damaging	Het
Vmn2r66	T	A	7: 85,005,743	K453*	probably null	Het
Vps13a	A	T	19: 16,725,572	D672E	probably damaging	Het
Vps54	A	G	11: 21,311,130	N599S	possibly damaging	Het
Zc3h13	A	T	14: 75,330,908	N1214Y	probably benign	Het
Zc3h18	T	G	8: 122,408,370		probably null	Het
Zfp51	A	G	17: 21,464,092	E323G	probably damaging	Het

Other mutations in Adamts20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Adamts20	APN	15	94394641	missense	probably benign
IGL00491:Adamts20	APN	15	94273232	missense	possibly damaging	0.89
IGL00502:Adamts20	APN	15	94403397	missense	probably damaging	0.99
IGL00672:Adamts20	APN	15	94341105	missense	probably damaging	0.99
IGL00840:Adamts20	APN	15	94282482	missense	probably damaging	1.00
IGL00909:Adamts20	APN	15	94379813	missense	probably damaging	1.00
IGL01101:Adamts20	APN	15	94344042	missense	probably damaging	1.00
IGL01137:Adamts20	APN	15	94394611	critical splice donor site	probably null
IGL01457:Adamts20	APN	15	94331448	missense	probably damaging	0.97
IGL01685:Adamts20	APN	15	94403446	missense	possibly damaging	0.81
IGL01949:Adamts20	APN	15	94326106	missense	probably benign	0.08
IGL02525:Adamts20	APN	15	94283078	splice site	probably null
IGL03088:Adamts20	APN	15	94329914	critical splice donor site	probably null
IGL03175:Adamts20	APN	15	94273255	nonsense	probably null
belt	UTSW	15	94345990	missense	probably damaging	1.00
buckeye	UTSW	15	94341087	missense	probably damaging	1.00
jack_white	UTSW	15		unclassified
Meowth	UTSW	15	94331458	missense	probably damaging	1.00
nidoking	UTSW	15	94403445	missense	probably damaging	1.00
panda	UTSW	15	94326699	intron	probably benign
pikachu	UTSW	15	94345990	missense	probably damaging	1.00
poliwag	UTSW	15	94394622	nonsense	probably null
splotch2	UTSW	15	94335561	intron	probably benign
wash	UTSW	15	94347670	nonsense	probably null
whitebelly	UTSW	15		unclassified
whopper	UTSW	15	94347810	missense	probably damaging	1.00
R0483:Adamts20	UTSW	15	94353571	missense	probably benign	0.00
R0514:Adamts20	UTSW	15	94270376	missense	probably damaging	1.00
R0568:Adamts20	UTSW	15	94291713	splice site	probably benign
R0730:Adamts20	UTSW	15	94347690	missense	probably benign	0.00
R0973:Adamts20	UTSW	15	94286371	missense	probably benign	0.00
R1339:Adamts20	UTSW	15	94322896	missense	probably benign	0.19
R1721:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1809:Adamts20	UTSW	15	94341087	missense	probably damaging	1.00
R1832:Adamts20	UTSW	15	94286344	missense	probably benign	0.00
R1846:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R1867:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1875:Adamts20	UTSW	15	94331396	missense	probably benign	0.01
R1930:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1931:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1932:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R2001:Adamts20	UTSW	15	94347718	missense	possibly damaging	0.96
R2116:Adamts20	UTSW	15	94355362	missense	probably damaging	1.00
R2162:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R2350:Adamts20	UTSW	15	94283916	missense	probably damaging	1.00
R2887:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2889:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2890:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R3109:Adamts20	UTSW	15	94345904	splice site	probably benign
R3719:Adamts20	UTSW	15	94361838	missense	probably damaging	0.99
R3832:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R3901:Adamts20	UTSW	15	94328845	missense	possibly damaging	0.81
R4398:Adamts20	UTSW	15	94333695	missense	possibly damaging	0.93
R4402:Adamts20	UTSW	15	94379946	missense	probably benign
R4431:Adamts20	UTSW	15	94344043	missense	probably damaging	1.00
R4479:Adamts20	UTSW	15	94403445	missense	probably damaging	1.00
R4482:Adamts20	UTSW	15	94345920	missense	probably damaging	1.00
R4503:Adamts20	UTSW	15	94379750	missense	probably damaging	0.99
R4671:Adamts20	UTSW	15	94403325	missense	possibly damaging	0.48
R4700:Adamts20	UTSW	15	94394622	nonsense	probably null
R4707:Adamts20	UTSW	15	94333647	missense	possibly damaging	0.53
R4725:Adamts20	UTSW	15	94351762	missense	probably damaging	0.99
R4771:Adamts20	UTSW	15	94351635	splice site	probably null
R4829:Adamts20	UTSW	15	94326396	missense	probably benign	0.01
R4937:Adamts20	UTSW	15	94379775	missense	probably benign
R4960:Adamts20	UTSW	15	94379774	missense	probably benign
R5270:Adamts20	UTSW	15	94282519	missense	probably benign	0.00
R5388:Adamts20	UTSW	15	94345778	missense	possibly damaging	0.81
R5410:Adamts20	UTSW	15	94281957	missense	possibly damaging	0.94
R5453:Adamts20	UTSW	15	94326088	missense	possibly damaging	0.69
R5687:Adamts20	UTSW	15	94325971	missense	probably benign	0.36
R5758:Adamts20	UTSW	15	94394650	missense	probably benign	0.00
R5801:Adamts20	UTSW	15	94347670	nonsense	probably null
R5834:Adamts20	UTSW	15	94353584	missense	probably damaging	0.99
R5993:Adamts20	UTSW	15	94338723	missense	probably damaging	0.99
R5997:Adamts20	UTSW	15	94379747	missense	probably damaging	1.00
R6044:Adamts20	UTSW	15	94282483	missense	probably damaging	1.00
R6058:Adamts20	UTSW	15	94330047	nonsense	probably null
R6217:Adamts20	UTSW	15	94338715	missense	probably benign	0.00
R6283:Adamts20	UTSW	15	94351721	missense	probably benign
R6354:Adamts20	UTSW	15	94347810	missense	probably damaging	1.00
R6415:Adamts20	UTSW	15	94324659	critical splice donor site	probably null
R6419:Adamts20	UTSW	15	94333675	missense	possibly damaging	0.84
R6476:Adamts20	UTSW	15	94361810	missense	probably benign	0.22
R6485:Adamts20	UTSW	15	94343971	missense	probably benign	0.17
R6517:Adamts20	UTSW	15	94283104	intron	probably null
R6675:Adamts20	UTSW	15	94331316	critical splice donor site	probably null
R6863:Adamts20	UTSW	15	94379746	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACTGTAGGTTTCTAGTCACTGTTC -3'
(R):5'- TCCGATTGTACCTGCAATTGAG -3'

Sequencing Primer
(F):5'- AGGTTTCTAGTCACTGTTCTCATATG -3'
(R):5'- CCGATTGTACCTGCAATTGAGAAGAC -3'

Posted On

2016-10-26