Incidental Mutation 'R5611:Adamts20'
ID438048
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94273280 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1854 (M1854T)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035342
AA Change: M1854T

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: M1854T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype Homozygous mutants have a white belt across the back in the midtrunk region and a white belly patch that coalesces to form a white belt.
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 Y170N probably damaging Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
Braf C T 6: 39,643,074 W231* noncoding transcript Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Ccdc129 G A 6: 55,967,118 A347T silent Het
Cd22 T A 7: 30,878,150 noncoding transcript Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D752V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Csn1s1 A T 5: 87,677,644 T16S probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Ear-ps2 G A 14: 44,047,060 A26T noncoding transcript Het
Fmn1 T A 2: 113,709,487 Y1289* probably null Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm15462 A G 3: 30,691,155 I1123M probably null Het
Gm16026 A G 1: 85,276,758 Q562R noncoding transcript Het
Gm9271 C A 7: 39,362,698 R827L noncoding transcript Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Hsd17b12 G A 2: 94,033,511 P317S noncoding transcript Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F1537L probably damaging Het
Mcm10 G A 2: 5,008,511 Q134* silent Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 S317P silent Het
Nop58 T A 1: 59,710,513 M474K unknown Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 M178V noncoding transcript Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I809T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W28695* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense
splotch2 UTSW 15 94335561 splice acceptor site
Wash UTSW 15 94347670 nonsense
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice acceptor site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1691:Adamts20 UTSW 15 94403565 splice acceptor site noncoding transcript
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2068:Adamts20 UTSW 15 94282458 splice donor site
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2331:Adamts20 UTSW 15 94283087 splice acceptor site
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2484:Adamts20 UTSW 15 94403360 missense silent
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site unknown
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 synonymous probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTGTAGGTTTCTAGTCACTGTTC -3'
(R):5'- TCCGATTGTACCTGCAATTGAG -3'

Sequencing Primer
(F):5'- AGGTTTCTAGTCACTGTTCTCATATG -3'
(R):5'- CCGATTGTACCTGCAATTGAGAAGAC -3'
Posted OnOct 26, 2016