Incidental Mutation 'R5611:Olfr121'
ID438054
Institutional Source Beutler Lab
Gene Symbol Olfr121
Ensembl Gene ENSMUSG00000060017
Gene Nameolfactory receptor 121
SynonymsMOR263-4, GA_x6K02T2PSCP-2211113-2212078
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.021) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37748855-37753169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37752084 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 77 (I77F)
Ref Sequence ENSEMBL: ENSMUSP00000084377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074555] [ENSMUST00000174675]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074555
AA Change: I77F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084377
Gene: ENSMUSG00000060017
AA Change: I77F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.9e-56 PFAM
Pfam:7TM_GPCR_Srsx 41 311 2.1e-5 PFAM
Pfam:7tm_1 47 296 8.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174675
AA Change: I77F

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133865
Gene: ENSMUSG00000060017
AA Change: I77F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Olfr121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Olfr121 APN 17 37752286 missense probably benign 0.03
R0100:Olfr121 UTSW 17 37752703 missense probably benign 0.12
R0328:Olfr121 UTSW 17 37752393 missense possibly damaging 0.57
R1641:Olfr121 UTSW 17 37752025 missense possibly damaging 0.90
R2358:Olfr121 UTSW 17 37752380 nonsense probably null
R3711:Olfr121 UTSW 17 37752380 nonsense probably null
R3712:Olfr121 UTSW 17 37752380 nonsense probably null
R4658:Olfr121 UTSW 17 37752163 missense probably damaging 1.00
R4913:Olfr121 UTSW 17 37752424 missense possibly damaging 0.86
R5229:Olfr121 UTSW 17 37752301 missense probably benign 0.00
R6159:Olfr121 UTSW 17 37752147 missense probably damaging 1.00
R6375:Olfr121 UTSW 17 37752099 missense probably benign
R6500:Olfr121 UTSW 17 37752686 missense probably damaging 1.00
R6818:Olfr121 UTSW 17 37752424 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCTTGTCTGTCAAACGCTTTG -3'
(R):5'- TACCCCATGACTCATTCGTG -3'

Sequencing Primer
(F):5'- GTCAAACGCTTTGCATTTTCCAAG -3'
(R):5'- CATGACTCATTCGTGTTGCATAG -3'
Posted On2016-10-26