Incidental Mutation 'R5611:Arhgef37'
ID438056
Institutional Source Beutler Lab
Gene Symbol Arhgef37
Ensembl Gene ENSMUSG00000045094
Gene NameRho guanine nucleotide exchange factor (GEF) 37
Synonyms4933429F08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61493794-61536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61507263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 242 (T242A)
Ref Sequence ENSEMBL: ENSMUSP00000130560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171629]
Predicted Effect probably benign
Transcript: ENSMUST00000171629
AA Change: T242A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130560
Gene: ENSMUSG00000045094
AA Change: T242A

DomainStartEndE-ValueType
RhoGEF 34 212 2.62e-35 SMART
Pfam:BAR 311 444 5.6e-10 PFAM
SH3 509 568 8.06e-1 SMART
SH3 606 665 2.56e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Arhgef37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgef37 APN 18 61523871 missense probably damaging 1.00
IGL00801:Arhgef37 APN 18 61499834 missense probably damaging 1.00
IGL01146:Arhgef37 APN 18 61518010 missense possibly damaging 0.93
IGL02052:Arhgef37 APN 18 61499768 missense probably damaging 1.00
IGL02489:Arhgef37 APN 18 61506469 missense possibly damaging 0.91
IGL03236:Arhgef37 APN 18 61523826 missense probably damaging 1.00
R0715:Arhgef37 UTSW 18 61508789 missense probably damaging 0.98
R0746:Arhgef37 UTSW 18 61517993 critical splice donor site probably null
R1843:Arhgef37 UTSW 18 61518050 missense probably damaging 0.99
R1934:Arhgef37 UTSW 18 61523943 missense probably benign 0.00
R1980:Arhgef37 UTSW 18 61508696 missense probably damaging 0.98
R2012:Arhgef37 UTSW 18 61504356 missense possibly damaging 0.56
R2237:Arhgef37 UTSW 18 61504406 missense probably damaging 1.00
R3024:Arhgef37 UTSW 18 61501888 missense probably damaging 0.96
R4864:Arhgef37 UTSW 18 61494925 missense probably benign
R4876:Arhgef37 UTSW 18 61498239 nonsense probably null
R5024:Arhgef37 UTSW 18 61506440 missense probably damaging 0.99
R5050:Arhgef37 UTSW 18 61504331 missense probably benign 0.43
R5512:Arhgef37 UTSW 18 61499774 nonsense probably null
R6051:Arhgef37 UTSW 18 61507274 missense probably damaging 0.97
R6488:Arhgef37 UTSW 18 61518052 missense probably benign 0.43
R6612:Arhgef37 UTSW 18 61494881 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTCAGAGCCTGATTCCTC -3'
(R):5'- CCATCCTGTGGGGTGTAACTTG -3'

Sequencing Primer
(F):5'- GAGCCTGATTCCTCTATAAGCAG -3'
(R):5'- CTTGATGGAGCAGAGTGCC -3'
Posted On2016-10-26