Incidental Mutation 'R5613:Olfr155'
ID438074
Institutional Source Beutler Lab
Gene Symbol Olfr155
Ensembl Gene ENSMUSG00000071000
Gene Nameolfactory receptor 155
SynonymsOR37A, Olfr37a, GA_x6K02T2N78B-16092200-16091241, mOR37a, MOR262-14
MMRRC Submission 043274-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5613 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43851565-43857595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43854528 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 73 (C73Y)
Ref Sequence ENSEMBL: ENSMUSP00000103492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095108] [ENSMUST00000107860]
Predicted Effect probably damaging
Transcript: ENSMUST00000095108
AA Change: C73Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092726
Gene: ENSMUSG00000071000
AA Change: C73Y

DomainStartEndE-ValueType
Pfam:7tm_1 42 297 2.8e-35 PFAM
Pfam:7tm_4 140 290 1.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107860
AA Change: C73Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103492
Gene: ENSMUSG00000071000
AA Change: C73Y

DomainStartEndE-ValueType
Pfam:7tm_4 32 315 9.7e-59 PFAM
Pfam:7tm_1 42 297 3.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Olfr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02729:Olfr155 APN 4 43854439 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0285:Olfr155 UTSW 4 43854398 missense possibly damaging 0.46
R0427:Olfr155 UTSW 4 43854417 missense probably damaging 1.00
R4468:Olfr155 UTSW 4 43854737 missense probably benign 0.08
R4548:Olfr155 UTSW 4 43854834 missense probably damaging 1.00
R4583:Olfr155 UTSW 4 43855262 missense probably benign
R4793:Olfr155 UTSW 4 43854323 missense probably benign 0.37
R4884:Olfr155 UTSW 4 43854890 missense probably damaging 1.00
R5016:Olfr155 UTSW 4 43854596 missense probably benign 0.02
R5220:Olfr155 UTSW 4 43854624 missense possibly damaging 0.89
R5805:Olfr155 UTSW 4 43855152 missense probably benign 0.15
R5955:Olfr155 UTSW 4 43854898 missense probably damaging 1.00
R6250:Olfr155 UTSW 4 43854363 missense possibly damaging 0.58
R6768:Olfr155 UTSW 4 43854351 missense probably benign 0.01
R6801:Olfr155 UTSW 4 43855206 nonsense probably null
R6835:Olfr155 UTSW 4 43854912 missense probably benign 0.00
W0251:Olfr155 UTSW 4 43855058 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCAAACCGAATGTACCATGGACAG -3'
(R):5'- GGTTGCAGATGGCCACATAAC -3'

Sequencing Primer
(F):5'- GGACAGATCCAATGAGACCGC -3'
(R):5'- GATGGCCACATAACGATCAAACG -3'
Posted On2016-10-26