Incidental Mutation 'R5613:Tlr4'
ID438075
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66840885 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 638 (S638R)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048096
AA Change: S638R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: S638R

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 noncoding transcript Het
9530053A07Rik A T 7: 28,142,878 noncoding transcript Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1372D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 noncoding transcript Het
Eya1 G T 1: 14,302,929 noncoding transcript Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 W49R unknown Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 A145V possibly damaging Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G232D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 D3560E unknown Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C possibly damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified noncoding transcript
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGAACATCAGAAATTCCTGCAG -3'
(R):5'- TGGCTACACCAGGAATAAAGTCTC -3'

Sequencing Primer
(F):5'- CATCAGAAATTCCTGCAGTGGGTC -3'
(R):5'- CACCAGGAATAAAGTCTCTGTAGTG -3'
Posted OnOct 26, 2016