Incidental Mutation 'R5613:Vmn2r115'
ID438107
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission 043274-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23345333 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 160 (I160L)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably benign
Transcript: ENSMUST00000168175
AA Change: I160L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: I160L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGTATGCTCTGGCTTTGGC -3'
(R):5'- TTCATGATCACTCAGGACAGGATG -3'

Sequencing Primer
(F):5'- CAACATGAACCCTGATATTTTGCC -3'
(R):5'- CAGCACAAGGTACAATGAATTCTTAG -3'
Posted On2016-10-26