Incidental Mutation 'R5614:Iars2'
ID438119
Institutional Source Beutler Lab
Gene Symbol Iars2
Ensembl Gene ENSMUSG00000026618
Gene Nameisoleucine-tRNA synthetase 2, mitochondrial
Synonyms2010002H18Rik
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location185284726-185329396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 185289508 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 866 (T866A)
Ref Sequence ENSEMBL: ENSMUSP00000027921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000069652]
Predicted Effect probably benign
Transcript: ENSMUST00000027921
AA Change: T866A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: T866A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 3.6e-172 PFAM
Pfam:tRNA-synt_1g 112 268 7e-15 PFAM
Pfam:tRNA-synt_1_2 334 462 3.8e-7 PFAM
Pfam:Anticodon_1 756 920 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069652
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195042
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Iars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Iars2 APN 1 185315954 missense probably benign 0.00
IGL00906:Iars2 APN 1 185296403 splice site probably benign
IGL01287:Iars2 APN 1 185296428 missense possibly damaging 0.90
IGL01814:Iars2 APN 1 185302775 nonsense probably null
IGL02016:Iars2 APN 1 185303306 missense probably damaging 0.99
IGL02995:Iars2 APN 1 185303301 missense probably benign
IGL03002:Iars2 APN 1 185322816 splice site probably null
IGL03248:Iars2 APN 1 185291432 unclassified probably benign
R0304:Iars2 UTSW 1 185287156 missense possibly damaging 0.77
R0711:Iars2 UTSW 1 185322388 splice site probably benign
R0783:Iars2 UTSW 1 185320874 missense probably damaging 1.00
R0990:Iars2 UTSW 1 185318627 missense probably damaging 1.00
R1867:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1868:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1957:Iars2 UTSW 1 185295671 missense possibly damaging 0.89
R2378:Iars2 UTSW 1 185327721 missense probably damaging 1.00
R3784:Iars2 UTSW 1 185287131 missense probably benign 0.17
R4061:Iars2 UTSW 1 185303386 missense possibly damaging 0.85
R4334:Iars2 UTSW 1 185303394 missense probably benign 0.35
R4708:Iars2 UTSW 1 185289357 missense probably benign 0.00
R4723:Iars2 UTSW 1 185315979 missense probably damaging 1.00
R4729:Iars2 UTSW 1 185316051 missense possibly damaging 0.71
R4851:Iars2 UTSW 1 185327648 missense probably damaging 0.99
R5033:Iars2 UTSW 1 185317928 missense possibly damaging 0.65
R5215:Iars2 UTSW 1 185294769 missense probably damaging 1.00
R5260:Iars2 UTSW 1 185323734 missense probably damaging 1.00
R5286:Iars2 UTSW 1 185323121 intron probably benign
R6659:Iars2 UTSW 1 185288076 missense possibly damaging 0.76
R6838:Iars2 UTSW 1 185329145 missense probably damaging 0.98
R7057:Iars2 UTSW 1 185289367 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGCAAGACTGAAATCCTAGTTTC -3'
(R):5'- GCAGCTCGGGAGAACATTAG -3'

Sequencing Primer
(F):5'- TTAATCCAAGATCTTAAATCCACCAC -3'
(R):5'- GGAGAACATTAGAAGTTCTGGTTCAC -3'
Posted On2016-10-26