Incidental Mutation 'R5614:Tgfb2'
ID438120
Institutional Source Beutler Lab
Gene Symbol Tgfb2
Ensembl Gene ENSMUSG00000039239
Gene Nametransforming growth factor, beta 2
SynonymsTgfb-2, Tgf-beta2
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location186622792-186705989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 186625513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 394 (I394F)
Ref Sequence ENSEMBL: ENSMUSP00000043849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000195201]
Predicted Effect probably benign
Transcript: ENSMUST00000045288
AA Change: I394F

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239
AA Change: I394F

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 20 284 1.1e-38 PFAM
TGFB 317 414 1.25e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194960
Predicted Effect probably benign
Transcript: ENSMUST00000195201
AA Change: I422F

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239
AA Change: I422F

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 9 138 2.4e-9 PFAM
Pfam:TGFb_propeptide 152 311 1.4e-23 PFAM
TGFB 345 442 6.1e-40 SMART
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Tgfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Tgfb2 APN 1 186704587 missense probably benign 0.39
IGL01304:Tgfb2 APN 1 186625473 missense probably damaging 0.99
IGL03028:Tgfb2 APN 1 186630609 critical splice donor site probably null
concise UTSW 1 186625513 missense probably benign 0.21
PIT4486001:Tgfb2 UTSW 1 186690727 missense probably benign 0.04
R2017:Tgfb2 UTSW 1 186630765 nonsense probably null
R2880:Tgfb2 UTSW 1 186704555 missense probably damaging 1.00
R4182:Tgfb2 UTSW 1 186629025 missense possibly damaging 0.95
R4292:Tgfb2 UTSW 1 186632538 missense probably damaging 1.00
R4478:Tgfb2 UTSW 1 186632499 missense probably damaging 1.00
R4801:Tgfb2 UTSW 1 186628913 nonsense probably null
R4802:Tgfb2 UTSW 1 186628913 nonsense probably null
R5247:Tgfb2 UTSW 1 186649914 intron probably null
R5254:Tgfb2 UTSW 1 186704483 missense probably damaging 1.00
R5988:Tgfb2 UTSW 1 186704581 missense probably benign 0.05
R6898:Tgfb2 UTSW 1 186632500 missense probably damaging 1.00
R6961:Tgfb2 UTSW 1 186649835 missense possibly damaging 0.67
R7098:Tgfb2 UTSW 1 186630637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCTGTAATCTCAGATGCC -3'
(R):5'- GATTGTGTACTCAGAGGCCC -3'

Sequencing Primer
(F):5'- CTCAGATGCCAGTTTTAACAAACAG -3'
(R):5'- TGGTATGCACATGAGAACCTGCTC -3'
Posted On2016-10-26