Incidental Mutation 'R5614:Odf2'
ID438121
Institutional Source Beutler Lab
Gene Symbol Odf2
Ensembl Gene ENSMUSG00000026790
Gene Nameouter dense fiber of sperm tails 2
SynonymsMMTEST29, cenexin
MMRRC Submission 043275-MU
Accession Numbers

Genbank: NM_001113213; MGI: 1098824 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29889221-29931746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29920867 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 538 (I538M)
Ref Sequence ENSEMBL: ENSMUSP00000109384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028128] [ENSMUST00000046571] [ENSMUST00000113755] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113762] [ENSMUST00000113763] [ENSMUST00000113764] [ENSMUST00000113765] [ENSMUST00000113767] [ENSMUST00000184845]
Predicted Effect probably damaging
Transcript: ENSMUST00000028128
AA Change: I524M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028128
Gene: ENSMUSG00000026790
AA Change: I524M

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000046571
AA Change: I538M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790
AA Change: I538M

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113755
AA Change: I538M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109384
Gene: ENSMUSG00000026790
AA Change: I538M

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 2.12e-5 PROSPERO
internal_repeat_1 461 495 2.12e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113756
AA Change: I538M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790
AA Change: I538M

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000113757
AA Change: I519M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790
AA Change: I519M

DomainStartEndE-ValueType
internal_repeat_2 101 119 9.13e-6 PROSPERO
coiled coil region 120 192 N/A INTRINSIC
internal_repeat_2 199 217 9.13e-6 PROSPERO
internal_repeat_1 243 279 3.83e-7 PROSPERO
internal_repeat_1 442 476 3.83e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113759
AA Change: I539M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790
AA Change: I539M

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113762
AA Change: I543M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109391
Gene: ENSMUSG00000026790
AA Change: I543M

DomainStartEndE-ValueType
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_1 267 303 1.9e-5 PROSPERO
internal_repeat_1 466 500 1.9e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113763
AA Change: I524M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109392
Gene: ENSMUSG00000026790
AA Change: I524M

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113764
AA Change: I524M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109393
Gene: ENSMUSG00000026790
AA Change: I524M

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000113765
AA Change: I543M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790
AA Change: I543M

DomainStartEndE-ValueType
internal_repeat_2 125 143 1.66e-5 PROSPERO
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_2 223 241 1.66e-5 PROSPERO
internal_repeat_1 267 303 7.56e-7 PROSPERO
internal_repeat_1 466 500 7.56e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113767
AA Change: I587M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109396
Gene: ENSMUSG00000026790
AA Change: I587M

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
coiled coil region 188 260 N/A INTRINSIC
internal_repeat_1 311 347 3e-5 PROSPERO
internal_repeat_1 510 544 3e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152503
Predicted Effect probably damaging
Transcript: ENSMUST00000184845
AA Change: I538M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790
AA Change: I538M

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 3.95e-5 PROSPERO
internal_repeat_1 461 495 3.95e-5 PROSPERO
Meta Mutation Damage Score 0.0348 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality before implantation and transmission ratio distortion while all heterozygous males display normal development and fertility. Males heterozygous for other alleles are either infertile orshow reduced fertility. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Odf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Odf2 APN 2 29893059 missense probably damaging 1.00
IGL01511:Odf2 APN 2 29914309 splice site probably benign
IGL01760:Odf2 APN 2 29914460 missense probably damaging 1.00
IGL02487:Odf2 APN 2 29920839 missense possibly damaging 0.80
IGL03047:Odf2 APN 2 29920895 splice site probably benign
IGL03057:Odf2 APN 2 29923645 intron probably benign
IGL03064:Odf2 APN 2 29901079 missense probably benign 0.28
3-1:Odf2 UTSW 2 29904075 nonsense probably null
IGL02837:Odf2 UTSW 2 29926713 missense probably damaging 0.99
R4025:Odf2 UTSW 2 29926815 missense probably damaging 1.00
R4227:Odf2 UTSW 2 29901284 intron probably benign
R4357:Odf2 UTSW 2 29892244 missense probably benign 0.00
R4417:Odf2 UTSW 2 29915321 splice site probably benign
R4512:Odf2 UTSW 2 29926097 unclassified probably null
R4705:Odf2 UTSW 2 29904034 missense probably damaging 1.00
R4815:Odf2 UTSW 2 29902240 missense possibly damaging 0.87
R5325:Odf2 UTSW 2 29912571 missense probably benign 0.19
R6998:Odf2 UTSW 2 29912617 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AACTCTGTCCACATTTGGGG -3'
(R):5'- TGTGCAGCCACTTCATCAGC -3'

Sequencing Primer
(F):5'- GGGTCATATTTGGAGACTTACTCAC -3'
(R):5'- GCCACTTCATCAGCCTCCAATC -3'
Posted On2016-10-26