Incidental Mutation 'R5614:Arfrp1'
ID438126
Institutional Source Beutler Lab
Gene Symbol Arfrp1
Ensembl Gene ENSMUSG00000038671
Gene NameADP-ribosylation factor related protein 1
Synonyms
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181357690-181365404 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 181359443 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108808] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000127988] [ENSMUST00000148252] [ENSMUST00000170190] [ENSMUST00000183499] [ENSMUST00000185118]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048269
Predicted Effect probably benign
Transcript: ENSMUST00000048608
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108808
SMART Domains Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108814
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124149
Predicted Effect probably benign
Transcript: ENSMUST00000127988
SMART Domains Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130772
Predicted Effect probably benign
Transcript: ENSMUST00000133856
Predicted Effect probably benign
Transcript: ENSMUST00000134651
Predicted Effect probably benign
Transcript: ENSMUST00000137700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147266
Predicted Effect probably benign
Transcript: ENSMUST00000148252
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152580
Predicted Effect probably benign
Transcript: ENSMUST00000170190
SMART Domains Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Miro 1 90 1.2e-9 PFAM
Pfam:Arf 1 140 8.5e-38 PFAM
Pfam:Gtr1_RagA 2 110 2.2e-6 PFAM
Pfam:SRPRB 4 118 6e-8 PFAM
Pfam:Ras 4 142 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183499
SMART Domains Protein: ENSMUSP00000138941
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 61 4.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184859
Predicted Effect probably benign
Transcript: ENSMUST00000185118
SMART Domains Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 120 1.6e-30 PFAM
Pfam:SRPRB 15 116 6.6e-8 PFAM
Pfam:Ras 19 116 2.1e-9 PFAM
Pfam:Miro 19 117 7.3e-12 PFAM
Pfam:MMR_HSR1 19 117 1.2e-7 PFAM
Pfam:Gtr1_RagA 19 119 5.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: The gene encodes a membrane-associated GTPase that is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) genes. It plays an essential role in Golgi function controlling recruitment of GRIP domain proteins and ARL1 to the trans-Golgi and trans-Golgi to plasma membrane trafficking of cell surface proteins such as E-cadherin. Deletion of this gene in mice leads to embryonic lethality during early gastrulation, which is at least partly caused by the disruption of E-cadherin trafficking to the cell surface and therefore lack of sufficient cell-cell adhesion in the embryo. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality and abnormal development of embryonic tissues. Mutant embryos display an abnormal egg cylinder and lack the ectoplacental and exocoelomic cavities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Arfrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1290:Arfrp1 UTSW 2 181364604 critical splice donor site probably null
R2152:Arfrp1 UTSW 2 181359694 missense probably benign
R5235:Arfrp1 UTSW 2 181359505 missense probably benign 0.00
R5479:Arfrp1 UTSW 2 181364398 missense probably damaging 0.98
R7129:Arfrp1 UTSW 2 181359551 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGGCAGGGCTCTAAATCTC -3'
(R):5'- CAGAGTCTTCAGGGCCAAGATTAG -3'

Sequencing Primer
(F):5'- CAGGGCTCTAAATCTCTGTCAGG -3'
(R):5'- GGCCAAGATTAGCCCTGTCTC -3'
Posted On2016-10-26