Incidental Mutation 'R5614:Zmym4'
ID438131
Institutional Source Beutler Lab
Gene Symbol Zmym4
Ensembl Gene ENSMUSG00000042446
Gene Namezinc finger, MYM-type 4
SynonymsZfp262, 6330503C17Rik
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126861939-126968135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126910936 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 475 (F475L)
Ref Sequence ENSEMBL: ENSMUSP00000101714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106108
AA Change: F475L

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101714
Gene: ENSMUSG00000042446
AA Change: F475L

DomainStartEndE-ValueType
TRASH 341 377 6.53e-4 SMART
TRASH 389 429 7.22e-6 SMART
TRASH 441 479 1.77e0 SMART
TRASH 486 525 4.95e-4 SMART
TRASH 531 569 1.05e-2 SMART
TRASH 579 615 2.82e1 SMART
low complexity region 640 649 N/A INTRINSIC
TRASH 687 723 8.49e-3 SMART
TRASH 729 764 1.14e-3 SMART
TRASH 772 810 4.48e-2 SMART
TRASH 816 851 2.06e-1 SMART
low complexity region 974 993 N/A INTRINSIC
low complexity region 1002 1021 N/A INTRINSIC
Pfam:DUF3504 1357 1527 1.7e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135003
AA Change: F223L
SMART Domains Protein: ENSMUSP00000120813
Gene: ENSMUSG00000042446
AA Change: F223L

DomainStartEndE-ValueType
TRASH 90 126 6.53e-4 SMART
TRASH 138 178 7.22e-6 SMART
TRASH 190 228 1.77e0 SMART
TRASH 235 274 3.05e-4 SMART
low complexity region 300 309 N/A INTRINSIC
TRASH 347 383 8.49e-3 SMART
TRASH 389 424 1.14e-3 SMART
TRASH 432 470 4.48e-2 SMART
TRASH 476 511 2.06e-1 SMART
low complexity region 634 653 N/A INTRINSIC
low complexity region 662 681 N/A INTRINSIC
Pfam:DUF3504 1017 1187 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152952
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Other mutations in Zmym4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zmym4 APN 4 126890058 missense probably benign
IGL00845:Zmym4 APN 4 126900613 missense probably benign 0.28
IGL01122:Zmym4 APN 4 126864252 missense probably damaging 1.00
IGL01374:Zmym4 APN 4 126868957 missense probably damaging 1.00
IGL01564:Zmym4 APN 4 126911280 missense possibly damaging 0.84
IGL02014:Zmym4 APN 4 126900669 missense possibly damaging 0.67
IGL02187:Zmym4 APN 4 126870273 missense probably damaging 0.97
IGL02887:Zmym4 APN 4 126948475 missense probably damaging 0.96
IGL03371:Zmym4 APN 4 126915088 missense possibly damaging 0.90
IGL03400:Zmym4 APN 4 126923127 missense probably benign 0.12
R0149:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0361:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0423:Zmym4 UTSW 4 126882319 splice site probably benign
R0532:Zmym4 UTSW 4 126898401 nonsense probably null
R0745:Zmym4 UTSW 4 126902703 splice site probably benign
R1183:Zmym4 UTSW 4 126925839 missense probably damaging 0.99
R1401:Zmym4 UTSW 4 126911169 missense probably benign 0.00
R1446:Zmym4 UTSW 4 126882482 missense probably damaging 1.00
R1491:Zmym4 UTSW 4 126882312 critical splice acceptor site probably null
R1566:Zmym4 UTSW 4 126911147 missense possibly damaging 0.94
R1962:Zmym4 UTSW 4 126902670 missense possibly damaging 0.47
R2398:Zmym4 UTSW 4 126923136 missense probably damaging 1.00
R2930:Zmym4 UTSW 4 126925523 missense probably benign 0.00
R3891:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R3892:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R4659:Zmym4 UTSW 4 126948428 splice site probably null
R4702:Zmym4 UTSW 4 126923165 missense probably benign 0.01
R5160:Zmym4 UTSW 4 126870184 missense probably damaging 0.97
R5773:Zmym4 UTSW 4 126905370 missense possibly damaging 0.52
R6450:Zmym4 UTSW 4 126895306 missense probably damaging 1.00
R6741:Zmym4 UTSW 4 126915085 missense possibly damaging 0.80
R7023:Zmym4 UTSW 4 126868800 missense probably damaging 1.00
R7315:Zmym4 UTSW 4 126882592 missense probably benign 0.09
U24488:Zmym4 UTSW 4 126925660 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATCCTACCCAAGGTTTCAACTC -3'
(R):5'- ATGTGCCAGAAGAACGCTG -3'

Sequencing Primer
(F):5'- GGTTTCAACTCCCCTGAAATGAAG -3'
(R):5'- CGCTGTCGTAAGTCACCTC -3'
Posted On2016-10-26