Incidental Mutation 'R5614:Atp13a2'
ID438132
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene NameATPase type 13A2
Synonyms
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location140986873-141007330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140992182 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000126461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
Predicted Effect probably benign
Transcript: ENSMUST00000037055
AA Change: T21A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622
AA Change: T21A

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125797
Predicted Effect probably benign
Transcript: ENSMUST00000127833
AA Change: T21A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622
AA Change: T21A

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156995
Predicted Effect probably benign
Transcript: ENSMUST00000168047
AA Change: T21A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: T21A

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140992198 missense probably benign 0.02
IGL01476:Atp13a2 APN 4 141000770 missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 141006152 missense probably benign 0.00
IGL02257:Atp13a2 APN 4 141006089 missense probably benign 0.00
IGL02589:Atp13a2 APN 4 141006411 missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 141001949 missense probably benign 0.00
IGL03032:Atp13a2 APN 4 141000355 missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 141006173 missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 141000397 missense possibly damaging 0.69
calla UTSW 4 140994332 nonsense probably null
eastern_moon UTSW 4 141005016 missense probably damaging 0.99
yucca_brevifolia UTSW 4 140993802 missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 141006968 missense possibly damaging 0.83
PIT4469001:Atp13a2 UTSW 4 140994127 missense unknown
R0634:Atp13a2 UTSW 4 141006929 unclassified probably benign
R0881:Atp13a2 UTSW 4 141003931 missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 141002460 missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140994332 nonsense probably null
R1838:Atp13a2 UTSW 4 140994332 nonsense probably null
R1856:Atp13a2 UTSW 4 141004012 missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140996371 missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 141004261 missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140995391 missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2133:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 141003155 missense probably benign 0.00
R2873:Atp13a2 UTSW 4 141002983 missense probably benign 0.00
R3025:Atp13a2 UTSW 4 140994348 missense probably damaging 1.00
R3939:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140992228 critical splice donor site probably null
R4357:Atp13a2 UTSW 4 141001904 missense probably benign 0.01
R4406:Atp13a2 UTSW 4 141006476 missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 141003276 critical splice donor site probably null
R5033:Atp13a2 UTSW 4 141000821 missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 141005138 missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 141000818 missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 141006070 missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 141004360 splice site probably null
R5846:Atp13a2 UTSW 4 140995596 missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 141007056 missense probably benign 0.34
R6512:Atp13a2 UTSW 4 141003218 missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 141006984 missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140999151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGTGACCAGTCTTGCC -3'
(R):5'- AAGGGCTTCCAGCGGAATAG -3'

Sequencing Primer
(F):5'- AGTGACCAGTCTTGCCAGCTG -3'
(R):5'- TTCCAGCGGAATAGCAGCC -3'
Posted On2016-10-26