Incidental Mutation 'R5614:4931409K22Rik'
ID438133
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24550142 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 330 (A330V)
Ref Sequence ENSEMBL: ENSMUSP00000085642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088302] [ENSMUST00000198887] [ENSMUST00000200634]
Predicted Effect probably benign
Transcript: ENSMUST00000088302
AA Change: A330V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: A330V

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198709
Predicted Effect probably benign
Transcript: ENSMUST00000198887
SMART Domains Protein: ENSMUSP00000142918
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199185
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
R7061:4931409K22Rik UTSW 5 24545065 missense probably benign 0.00
R7131:4931409K22Rik UTSW 5 24548956 missense possibly damaging 0.81
R7156:4931409K22Rik UTSW 5 24552650 missense probably benign 0.05
R7248:4931409K22Rik UTSW 5 24544271 missense probably benign 0.00
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGACCATTCCCTTTCAGG -3'
(R):5'- AAGGGCCATCTCCACACTTG -3'

Sequencing Primer
(F):5'- TTCAGGGCCATGAGTGCCTTC -3'
(R):5'- GTTTCCCATTTCCCTGAGAGAAGAG -3'
Posted On2016-10-26