Incidental Mutation 'R5614:Bud23'
ID438136
Institutional Source Beutler Lab
Gene Symbol Bud23
Ensembl Gene ENSMUSG00000005378
Gene NameBUD23, rRNA methyltransferase and ribosome maturation factor
Synonyms1110003N24Rik, Wbscr22
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score109
Status Validated
Chromosome5
Chromosomal Location135052957-135064959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 135059112 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 152 (A152S)
Ref Sequence ENSEMBL: ENSMUSP00000106836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000129691] [ENSMUST00000141309] [ENSMUST00000148549]
Predicted Effect probably benign
Transcript: ENSMUST00000071677
AA Change: A130S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378
AA Change: A130S

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085984
AA Change: A152S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378
AA Change: A152S

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111205
AA Change: A152S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378
AA Change: A152S

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129013
Predicted Effect probably benign
Transcript: ENSMUST00000129691
SMART Domains Protein: ENSMUSP00000120383
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:WBS_methylT 88 138 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134180
Predicted Effect probably benign
Transcript: ENSMUST00000141309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147756
Predicted Effect probably benign
Transcript: ENSMUST00000148549
SMART Domains Protein: ENSMUSP00000118370
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_23 3 89 1.4e-8 PFAM
Pfam:Methyltransf_11 27 93 5.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157383
Predicted Effect probably benign
Transcript: ENSMUST00000202478
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Bud23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Bud23 APN 5 135061081 missense probably damaging 0.99
IGL03281:Bud23 APN 5 135063887 missense probably benign 0.01
R1103:Bud23 UTSW 5 135061139 missense probably damaging 1.00
R1765:Bud23 UTSW 5 135056043 missense probably benign 0.00
R3710:Bud23 UTSW 5 135056350 missense possibly damaging 0.54
R4486:Bud23 UTSW 5 135063925 unclassified probably null
R5109:Bud23 UTSW 5 135061023 intron probably benign
R5550:Bud23 UTSW 5 135063890 missense probably benign
R5822:Bud23 UTSW 5 135063921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCAGCTCTTCGCACCTG -3'
(R):5'- AGCTCCAGGCAGCAAATTAG -3'

Sequencing Primer
(F):5'- CCTCCAAGTGTGAGGATTCCATG -3'
(R):5'- CTCCAGGCAGCAAATTAGAGTGG -3'
Posted On2016-10-26