Incidental Mutation 'R5614:Rnf6'
ID438137
Institutional Source Beutler Lab
Gene Symbol Rnf6
Ensembl Gene ENSMUSG00000029634
Gene Namering finger protein (C3H2C3 type) 6
Synonyms5730419H05Rik, 1200013I08Rik
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146209192-146221555 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 146218100 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067837] [ENSMUST00000159074] [ENSMUST00000161331] [ENSMUST00000161574] [ENSMUST00000161859] [ENSMUST00000169407]
Predicted Effect probably null
Transcript: ENSMUST00000067837
SMART Domains Protein: ENSMUSP00000067559
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159074
SMART Domains Protein: ENSMUSP00000123926
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161331
SMART Domains Protein: ENSMUSP00000125611
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161574
SMART Domains Protein: ENSMUSP00000123730
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161725
Predicted Effect probably null
Transcript: ENSMUST00000161859
SMART Domains Protein: ENSMUSP00000124293
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162219
SMART Domains Protein: ENSMUSP00000123708
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 157 185 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169407
SMART Domains Protein: ENSMUSP00000128774
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Meta Mutation Damage Score 0.6352 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Rnf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rnf6 APN 5 146211905 missense possibly damaging 0.86
IGL01432:Rnf6 APN 5 146216121 missense possibly damaging 0.61
IGL01722:Rnf6 APN 5 146210226 missense probably benign
IGL01866:Rnf6 APN 5 146210907 missense probably damaging 0.99
R0141:Rnf6 UTSW 5 146211835 missense possibly damaging 0.95
R0551:Rnf6 UTSW 5 146211395 missense possibly damaging 0.65
R0619:Rnf6 UTSW 5 146210721 missense possibly damaging 0.58
R0685:Rnf6 UTSW 5 146211658 missense probably damaging 0.99
R1363:Rnf6 UTSW 5 146211559 missense probably benign
R1387:Rnf6 UTSW 5 146211245 missense probably benign 0.00
R1671:Rnf6 UTSW 5 146211188 nonsense probably null
R2047:Rnf6 UTSW 5 146211864 missense probably damaging 0.99
R2074:Rnf6 UTSW 5 146210906 missense probably damaging 0.98
R2107:Rnf6 UTSW 5 146211281 missense probably damaging 0.99
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2873:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2874:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R4361:Rnf6 UTSW 5 146211279 missense probably damaging 1.00
R5421:Rnf6 UTSW 5 146210529 missense probably benign 0.06
R5437:Rnf6 UTSW 5 146210280 missense probably damaging 1.00
R5848:Rnf6 UTSW 5 146211149 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTGCCCATTTCTTACCAGGGG -3'
(R):5'- AGTCTCTAAAGGCAGTGGTGAATC -3'

Sequencing Primer
(F):5'- TTCTTACCAGGGGTGCCTAAAAG -3'
(R):5'- TCACAGATGAAGAGATTGTTAGTGGC -3'
Posted On2016-10-26