Incidental Mutation 'R5614:Fus'
ID438140
Institutional Source Beutler Lab
Gene Symbol Fus
Ensembl Gene ENSMUSG00000030795
Gene Namefused in sarcoma
SynonymsD430004D17Rik, hnRNP P2, pigpen, D930039C12Rik, translocated in liposarcoma, Tls
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127967457-127985701 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 127974371 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077609] [ENSMUST00000106251] [ENSMUST00000121616]
Predicted Effect probably benign
Transcript: ENSMUST00000077609
SMART Domains Protein: ENSMUSP00000076801
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 48 67 N/A INTRINSIC
low complexity region 72 104 N/A INTRINSIC
low complexity region 110 179 N/A INTRINSIC
low complexity region 185 253 N/A INTRINSIC
RRM 278 359 3.85e-16 SMART
ZnF_RBZ 416 442 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106251
SMART Domains Protein: ENSMUSP00000101858
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
low complexity region 73 105 N/A INTRINSIC
low complexity region 111 180 N/A INTRINSIC
low complexity region 186 254 N/A INTRINSIC
RRM 279 360 3.85e-16 SMART
ZnF_RBZ 417 443 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121616
SMART Domains Protein: ENSMUSP00000112721
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
low complexity region 73 105 N/A INTRINSIC
low complexity region 111 176 N/A INTRINSIC
ZnF_RBZ 179 205 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174196
Predicted Effect probably benign
Transcript: ENSMUST00000174632
SMART Domains Protein: ENSMUSP00000133820
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
Pfam:RRM_1 6 56 6.6e-9 PFAM
ZnF_RBZ 77 103 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205351
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired lymphocyte development, chromosomal instability, increased cellular radiation sensitivity, high neonatal mortality, and male sterility associated with lack of chromosomal pairing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Fus
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Fus APN 7 127981507 missense possibly damaging 0.53
IGL02622:Fus APN 7 127985622 missense probably damaging 0.99
IGL02951:Fus APN 7 127981837 unclassified probably benign
IGL03029:Fus APN 7 127985540 unclassified probably benign
R0588:Fus UTSW 7 127985574 missense probably damaging 0.99
R0674:Fus UTSW 7 127972776 unclassified probably benign
R0686:Fus UTSW 7 127972763 unclassified probably benign
R0746:Fus UTSW 7 127985424 unclassified probably benign
R1562:Fus UTSW 7 127979922 missense probably damaging 1.00
R1733:Fus UTSW 7 127981545 missense probably benign 0.01
R2186:Fus UTSW 7 127985534 unclassified probably benign
R2200:Fus UTSW 7 127977228 missense probably damaging 0.99
R4537:Fus UTSW 7 127975915 missense probably damaging 0.99
R4981:Fus UTSW 7 127967555 start gained probably benign
R5206:Fus UTSW 7 127969797 missense unknown
R5283:Fus UTSW 7 127985547 unclassified probably benign
R6182:Fus UTSW 7 127977293 missense probably damaging 0.97
R6239:Fus UTSW 7 127981434 missense possibly damaging 0.91
R6939:Fus UTSW 7 127972569 unclassified probably benign
R7130:Fus UTSW 7 127974413 missense unknown
X0061:Fus UTSW 7 127985433 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTGATAAGCTCAAAGGTCAG -3'
(R):5'- AGTTAGCACACATCTGGCAGC -3'

Sequencing Primer
(F):5'- TCAAAGGTCAGACAAGGGTGGTC -3'
(R):5'- CTTCTGGAGGTGGCTACAGAC -3'
Posted On2016-10-26