Incidental Mutation 'R5614:Ces1b'
ID438144
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93068208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 254 (I254M)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect probably benign
Transcript: ENSMUST00000109582
AA Change: I254M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: I254M

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGTGACTAGAAGGGATACACTTATG -3'
(R):5'- TGTGGGATATAGTATCTACATCTGC -3'

Sequencing Primer
(F):5'- GGGATACACTTATGTACCAGTTTCAC -3'
(R):5'- CCACAAGATTAGTTTTGGTGCCAC -3'
Posted On2016-10-26