Incidental Mutation 'R5614:Ces1d'
ID438145
Institutional Source Beutler Lab
Gene Symbol Ces1d
Ensembl Gene ENSMUSG00000056973
Gene Namecarboxylesterase 1D
SynonymsTGH, Ces3
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93166068-93197838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93176204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 375 (T375A)
Ref Sequence ENSEMBL: ENSMUSP00000034172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034172]
Predicted Effect probably benign
Transcript: ENSMUST00000034172
AA Change: T375A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034172
Gene: ENSMUSG00000056973
AA Change: T375A

DomainStartEndE-ValueType
Pfam:COesterase 1 545 4.9e-169 PFAM
Pfam:Abhydrolase_3 136 256 8.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148340
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased blood lipids, improved glucose tolerance, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Ces1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Ces1d APN 8 93195089 splice site probably benign
IGL01707:Ces1d APN 8 93189550 missense possibly damaging 0.57
IGL01753:Ces1d APN 8 93192810 missense probably damaging 1.00
IGL01918:Ces1d APN 8 93178075 missense probably benign 0.00
IGL02730:Ces1d APN 8 93186016 missense probably benign
IGL02819:Ces1d APN 8 93169718 splice site probably null
IGL02824:Ces1d APN 8 93169718 splice site probably null
IGL02825:Ces1d APN 8 93169718 splice site probably null
IGL02858:Ces1d APN 8 93169718 splice site probably null
IGL02877:Ces1d APN 8 93169718 splice site probably null
IGL02946:Ces1d APN 8 93169718 splice site probably null
IGL02990:Ces1d APN 8 93169718 splice site probably null
IGL03024:Ces1d APN 8 93169718 splice site probably null
IGL03080:Ces1d APN 8 93169718 splice site probably null
IGL03081:Ces1d APN 8 93169718 splice site probably null
IGL03082:Ces1d APN 8 93169718 splice site probably null
IGL03096:Ces1d APN 8 93178042 missense probably benign 0.01
IGL03165:Ces1d APN 8 93189519 missense probably benign 0.02
IGL03233:Ces1d APN 8 93195079 missense probably benign
IGL03263:Ces1d APN 8 93169718 splice site probably null
IGL03310:Ces1d APN 8 93175188 splice site probably benign
IGL03338:Ces1d APN 8 93169718 splice site probably null
IGL03357:Ces1d APN 8 93169718 splice site probably null
R0125:Ces1d UTSW 8 93175182 splice site probably benign
R0393:Ces1d UTSW 8 93192772 missense probably damaging 1.00
R0483:Ces1d UTSW 8 93197679 missense probably benign
R0746:Ces1d UTSW 8 93189468 missense probably damaging 1.00
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1607:Ces1d UTSW 8 93186118 missense probably benign 0.08
R1879:Ces1d UTSW 8 93189498 missense probably benign 0.35
R2881:Ces1d UTSW 8 93195031 missense probably damaging 1.00
R3870:Ces1d UTSW 8 93175086 missense probably benign 0.15
R4004:Ces1d UTSW 8 93178092 missense probably benign 0.03
R4573:Ces1d UTSW 8 93181534 missense probably benign 0.00
R4647:Ces1d UTSW 8 93166410 missense probably damaging 1.00
R4985:Ces1d UTSW 8 93175144 missense possibly damaging 0.61
R5080:Ces1d UTSW 8 93181547 missense probably benign 0.02
R5209:Ces1d UTSW 8 93175188 splice site probably benign
R5351:Ces1d UTSW 8 93178078 missense probably damaging 1.00
R5433:Ces1d UTSW 8 93186036 missense probably benign 0.02
R5722:Ces1d UTSW 8 93178128 missense probably benign 0.01
R6257:Ces1d UTSW 8 93166397 missense probably benign 0.03
R7238:Ces1d UTSW 8 93178135 missense probably benign 0.01
Z1088:Ces1d UTSW 8 93175108 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCAACACACCTGGATGG -3'
(R):5'- TGTGGCTTCTGATGTGATCAATAC -3'

Sequencing Primer
(F):5'- GTTTCCACCATCAAACTGG -3'
(R):5'- GCTTCTGATGTGATCAATACCTTTAC -3'
Posted On2016-10-26