Incidental Mutation 'R5614:Thg1l'
ID438154
Institutional Source Beutler Lab
Gene Symbol Thg1l
Ensembl Gene ENSMUSG00000011254
Gene NametRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Synonyms5730409G07Rik, 1700121M19Rik
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location45946843-45955494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45950227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 175 (Y175C)
Ref Sequence ENSEMBL: ENSMUSP00000104877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011398] [ENSMUST00000109254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011398
AA Change: Y235C

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000011398
Gene: ENSMUSG00000011254
AA Change: Y235C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Thg1 35 164 1e-53 PFAM
Pfam:Thg1C 167 283 2.6e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109254
AA Change: Y175C

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104877
Gene: ENSMUSG00000011254
AA Change: Y175C

DomainStartEndE-ValueType
Pfam:Thg1 2 104 2.1e-37 PFAM
Pfam:Thg1C 105 235 6.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133851
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial protein that is induced by high levels of glucose and is associated with diabetic nephropathy. The encoded protein appears to increase mitochondrial biogenesis, which could lead to renal fibrosis. Another function of this protein is that of a guanyltransferase, adding GMP to the 5' end of tRNA(His). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Thg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Thg1l APN 11 45954221 missense probably benign 0.02
IGL01111:Thg1l APN 11 45948224 missense probably damaging 0.98
IGL01899:Thg1l APN 11 45954191 missense probably damaging 0.96
IGL02097:Thg1l APN 11 45950228 missense probably benign 0.09
IGL02746:Thg1l APN 11 45948227 nonsense probably null
R0547:Thg1l UTSW 11 45954191 missense probably damaging 1.00
R1099:Thg1l UTSW 11 45954161 missense possibly damaging 0.76
R1998:Thg1l UTSW 11 45950203 missense possibly damaging 0.95
R2568:Thg1l UTSW 11 45951565 missense probably benign
R4738:Thg1l UTSW 11 45954191 missense probably damaging 1.00
R6191:Thg1l UTSW 11 45954161 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGGCCACTACTGACTGATG -3'
(R):5'- TGATGGCAGACACCTAGAGTAG -3'

Sequencing Primer
(F):5'- GCCACTACTGACTGATGAGCATTC -3'
(R):5'- CACCTAGAGTAGAATATTAGGGACTG -3'
Posted On2016-10-26