Incidental Mutation 'R5614:Chrne'
ID438155
Institutional Source Beutler Lab
Gene Symbol Chrne
Ensembl Gene ENSMUSG00000014609
Gene Namecholinergic receptor, nicotinic, epsilon polypeptide
SynonymsAChrepsilon, Acre
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70614883-70619216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70615053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 469 (V469I)
Ref Sequence ENSEMBL: ENSMUSP00000014753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000135865] [ENSMUST00000144960] [ENSMUST00000180052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014753
AA Change: V469I

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609
AA Change: V469I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072237
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072873
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079244
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102556
AA Change: V468I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609
AA Change: V468I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102558
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102559
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect probably benign
Transcript: ENSMUST00000136663
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes the epsilon subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. In mice, deficiency of this gene can lead to a decline in the number of nicotinic acetylcholine receptors at neuromuscular junctions and causes progressive muscle weakness, atrophy and premature death. Mutations in this gene serve as a pathophysiological model for human congenital myasthenia. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced AChR receptor density at neuromuscular synapses, impaired neuromuscular transmission, progressive muscular weakness and atrophy, and lethality at 2-3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Chrne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Chrne APN 11 70615762 missense probably benign 0.00
IGL00950:Chrne APN 11 70619157 unclassified probably benign
IGL01875:Chrne APN 11 70618672 splice site probably null
IGL03201:Chrne APN 11 70618512 missense probably benign 0.02
IGL03303:Chrne APN 11 70615100 missense possibly damaging 0.77
pip-squeak UTSW 11 70615130 critical splice acceptor site probably null
R0419:Chrne UTSW 11 70615723 missense probably benign
R0848:Chrne UTSW 11 70615413 missense probably benign 0.02
R1378:Chrne UTSW 11 70615130 critical splice acceptor site probably null
R1623:Chrne UTSW 11 70618428 missense possibly damaging 0.86
R2170:Chrne UTSW 11 70618497 missense probably damaging 1.00
R2437:Chrne UTSW 11 70615260 missense possibly damaging 0.92
R3945:Chrne UTSW 11 70617043 missense possibly damaging 0.95
R4612:Chrne UTSW 11 70617022 missense probably damaging 0.99
R4923:Chrne UTSW 11 70615275 missense possibly damaging 0.62
R5172:Chrne UTSW 11 70615526 missense probably benign 0.00
R5288:Chrne UTSW 11 70615087 missense possibly damaging 0.63
R5384:Chrne UTSW 11 70615087 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACTTCCCTGAGGAGTTGGAC -3'
(R):5'- TGAACTTTGTGGCTGAGAGC -3'

Sequencing Primer
(F):5'- GAGTTGGACCCACCCACATG -3'
(R):5'- ACAAGAGACCAGGAAGCCACTG -3'
Posted On2016-10-26