Incidental Mutation 'R5615:0610010F05Rik'
List |< first << previous [record 46 of 386652] next >> last >|
ID438203
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23564961-23633631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23606759 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 407 (L407H)
Ref Sequence ENSEMBL: ENSMUSP00000090955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect probably damaging
Transcript: ENSMUST00000043356
AA Change: L407H

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: L407H

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093267
AA Change: L261H

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208
AA Change: L261H

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109532
AA Change: L407H

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: L407H

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155903
AA Change: L407H

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: L407H

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180260
AA Change: L407H

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: L407H

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Atg16l1 T C 1: 87,775,826 C361R noncoding transcript Het
Atp1a2 G A 1: 172,284,947 R549* probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 S429P unknown Het
Cyp4f16 A T 17: 32,540,476 I155F noncoding transcript Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Gm26672 T G 18: 37,768,079 S655A probably damaging Het
Hemk1 T A 9: 107,330,824 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2159T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y113H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mturn G A 6: 54,699,057 R114Q unknown Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Polq T C 16: 37,061,615 S908P noncoding transcript Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S168A probably benign Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 unknown Het
Trnt1 T G 6: 106,769,846 L21V noncoding transcript Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a6a TTCATCA TTCA 1: 88,216,158 unknown Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Xpr1 A T 1: 155,293,262 *301R noncoding transcript Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice donor site probably benign 0.00
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably damaging 1.00
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 1.00
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice donor site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice donor site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense possibly damaging 0.64
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1353:0610010F05Rik UTSW 11 23620217 splice donor site probably benign
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 1.00
R1568:0610010F05Rik UTSW 11 23589971 missense possibly damaging 0.90
R2163:0610010F05Rik UTSW 11 23576826 splice acceptor site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 unclassified probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTGTGTGGGTATAACCAAC -3'
(R):5'- AATGACTGGAAGGTAGGCCTC -3'

Sequencing Primer
(F):5'- GACATGAAACTTACAAAGAGTCAAAG -3'
(R):5'- AGTGAATTCCCACAGTTGGTACC -3'
Posted OnOct 26, 2016