Incidental Mutation 'R5579:Polr1b'
ID438243
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
MMRRC Submission 043267-MU
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5579 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129110108 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 352 (K352R)
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect probably damaging
Transcript: ENSMUST00000028874
AA Change: K352R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395
AA Change: K352R

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103205
AA Change: K352R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: K352R

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,700,275 S345P probably benign Het
6430573F11Rik T C 8: 36,512,041 V266A probably benign Het
Abca3 G T 17: 24,376,729 C352F probably damaging Het
Abce1 A T 8: 79,700,586 I237N possibly damaging Het
Acrbp A G 6: 125,061,099 D421G probably benign Het
Adam8 T A 7: 139,988,984 Y201F probably benign Het
Adgrf1 T A 17: 43,311,064 C731S probably damaging Het
AF067063 T A 13: 119,828,415 M82L probably benign Het
Akap8l A T 17: 32,321,942 I529N probably damaging Het
Akap9 G A 5: 4,064,714 G114D possibly damaging Het
Alox12b T A 11: 69,162,932 D158E probably benign Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Ankrd42 T C 7: 92,590,182 Y466C possibly damaging Het
Apobr T C 7: 126,587,675 I786T probably benign Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Btnl1 T C 17: 34,381,552 probably null Het
Ccdc174 A G 6: 91,881,350 probably null Het
Ccdc183 T C 2: 25,615,422 D177G possibly damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cep162 G A 9: 87,203,671 A1200V probably benign Het
Clic3 T C 2: 25,458,307 L128P probably damaging Het
Cntnap5b A T 1: 100,383,395 R538* probably null Het
Cntnap5b A T 1: 100,383,399 Q539L probably benign Het
Coq7 A T 7: 118,517,335 N214K unknown Het
Cramp1l G A 17: 24,973,113 H1018Y possibly damaging Het
Crtac1 T A 19: 42,304,806 D288V probably damaging Het
Dab2ip C T 2: 35,715,327 R132* probably null Het
Dis3l C A 9: 64,330,835 C125F probably benign Het
Dnmt1 A T 9: 20,920,205 V543D probably damaging Het
Dock9 A T 14: 121,599,695 L67Q probably damaging Het
Ehbp1 A T 11: 22,137,846 S413T probably damaging Het
Endov A G 11: 119,505,097 I158V probably benign Het
Epb41l4b A G 4: 57,064,802 V469A possibly damaging Het
Etf1 G A 18: 34,913,601 P119S probably damaging Het
Fam135a A G 1: 24,029,727 L491P possibly damaging Het
Fancd2 A T 6: 113,560,051 probably null Het
Fank1 T A 7: 133,869,329 probably null Het
Fbxo18 A G 2: 11,748,993 I846T probably damaging Het
Gas2l3 T C 10: 89,414,066 T397A probably benign Het
Gga1 T C 15: 78,893,188 V513A probably damaging Het
Ggt1 T C 10: 75,585,948 V543A probably damaging Het
Gm11596 A T 11: 99,792,891 C134* probably null Het
Gnal C T 18: 67,088,771 R82C unknown Het
Hat1 T C 2: 71,410,238 V92A possibly damaging Het
Icosl C T 10: 78,073,763 R181C probably damaging Het
Ift46 A G 9: 44,786,863 M208V possibly damaging Het
Ighv1-26 T C 12: 114,788,599 K42E possibly damaging Het
Ipo5 A G 14: 120,938,613 K617E probably benign Het
Irx5 A G 8: 92,359,913 D208G probably benign Het
Itgal T G 7: 127,306,929 V397G probably benign Het
Itpr2 G A 6: 146,173,366 R2297* probably null Het
Itpr3 A G 17: 27,113,519 D1779G probably damaging Het
Krt4 T A 15: 101,921,234 E286D probably benign Het
Loxl4 C T 19: 42,604,290 G317E probably damaging Het
Mapk6 T G 9: 75,388,062 H718P possibly damaging Het
Mark2 A C 19: 7,282,816 V14G probably damaging Het
Mbd5 A G 2: 49,272,814 T1103A possibly damaging Het
Mcph1 A G 8: 18,632,293 E482G probably benign Het
Mme G A 3: 63,348,645 E509K probably damaging Het
Mrgbp A G 2: 180,585,483 T204A probably damaging Het
Mycbp2 A T 14: 103,291,333 F430I probably damaging Het
Myo6 A G 9: 80,217,720 D27G probably damaging Het
Ncoa6 A G 2: 155,406,677 L1569S probably damaging Het
Ndc1 T A 4: 107,380,704 F235Y possibly damaging Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Olfr1176 A T 2: 88,340,413 I283F possibly damaging Het
Olfr301 T A 7: 86,412,726 Y121* probably null Het
Olfr608 G A 7: 103,470,914 V292M probably damaging Het
Osbpl1a G T 18: 12,841,192 A62E probably damaging Het
Osbpl1a A C 18: 12,892,262 S333A probably benign Het
Otud4 C T 8: 79,664,108 T417I probably benign Het
Pagr1a T C 7: 127,015,442 E197G probably damaging Het
Pcdh18 T C 3: 49,744,977 Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,731,637 I162L probably benign Het
Pdpr T A 8: 111,123,816 Y462N probably damaging Het
Pkhd1 A T 1: 20,523,142 H1582Q probably damaging Het
Poteg G A 8: 27,448,037 V12M probably damaging Het
Pou2f1 A C 1: 165,915,162 V54G probably damaging Het
Ppme1 A G 7: 100,344,975 L177P probably damaging Het
Prkce A G 17: 86,619,948 D550G probably damaging Het
Prrc2c A G 1: 162,680,758 probably null Het
Ptpn22 A G 3: 103,882,139 probably null Het
Rabif G A 1: 134,506,205 V86M probably damaging Het
Rbm25 T A 12: 83,668,507 M484K probably benign Het
Rcn2 G A 9: 56,057,429 A224T probably benign Het
Rexo5 T A 7: 119,834,403 probably null Het
Rnase1 A T 14: 51,145,762 I45N probably benign Het
Rnmt T A 18: 68,306,115 D98E possibly damaging Het
Rprd2 A G 3: 95,785,059 F188L probably damaging Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Slc7a15 T C 12: 8,539,344 I68V probably benign Het
Slco1a5 A T 6: 142,242,125 V496D possibly damaging Het
Slitrk6 T G 14: 110,751,217 S353R possibly damaging Het
Smpd5 T A 15: 76,295,125 I53K possibly damaging Het
Tas2r108 T C 6: 40,494,087 S166P probably benign Het
Tecpr1 C A 5: 144,214,344 V245L possibly damaging Het
Tenm3 G T 8: 48,236,764 N1929K probably damaging Het
Tigd5 T G 15: 75,911,025 F412C probably damaging Het
Timm17a A T 1: 135,306,188 S74T possibly damaging Het
Tle1 A T 4: 72,139,808 L60Q probably damaging Het
Tmem132d T C 5: 127,796,000 E515G possibly damaging Het
Tmem65 T C 15: 58,794,397 N115S probably benign Het
Trmt5 C A 12: 73,281,652 R259L possibly damaging Het
Ttc37 T C 13: 76,185,200 W25R probably damaging Het
Vmn2r50 A T 7: 10,050,089 W153R probably benign Het
Vwa3a T G 7: 120,768,173 S184A probably benign Het
Zbtb25 A G 12: 76,349,164 L428P possibly damaging Het
Zbtb49 C T 5: 38,200,816 D698N probably damaging Het
Zbtb8os T G 4: 129,340,735 D35E probably damaging Het
Zfp316 T C 5: 143,264,491 T56A unknown Het
Zfp334 A T 2: 165,380,487 C545* probably null Het
Zmiz1 C A 14: 25,644,856 S247R probably damaging Het
Zscan18 A G 7: 12,775,381 probably benign Het
Zzef1 T C 11: 72,900,637 V2189A probably damaging Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCACAGCTCCAGACTTTG -3'
(R):5'- AGGAATCATCAGCCTGCAGAC -3'

Sequencing Primer
(F):5'- TTCCATCAAGGTTGCCAGTGAAG -3'
(R):5'- ATCATCAGCCTGCAGACAGTGG -3'
Posted On2016-10-26