Incidental Mutation 'R5580:Hmcn1'
ID438352
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Namehemicentin 1
SynonymsLOC240793, EG545370
MMRRC Submission 043134-MU
Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5580 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150562524-150993435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150577539 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 5342 (P5342S)
Ref Sequence ENSEMBL: ENSMUSP00000074340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197] [ENSMUST00000177036]
Predicted Effect probably benign
Transcript: ENSMUST00000074783
AA Change: P5342S

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: P5342S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137197
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137909
Predicted Effect probably benign
Transcript: ENSMUST00000177036
SMART Domains Protein: ENSMUSP00000134985
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
EGF_CA 16 57 6.8e-8 SMART
EGF_CA 58 100 3.51e-10 SMART
EGF_CA 101 140 2.78e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Gnl3 T C 14: 31,015,285 K212R probably benign Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Itih2 T C 2: 10,123,476 E138G probably damaging Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Muc5b A G 7: 141,861,347 T2677A possibly damaging Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pi4ka A G 16: 17,281,087 S1978P probably damaging Het
Pik3c2g A T 6: 139,626,533 Q239L probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Syngap1 G A 17: 26,962,331 A9T probably damaging Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150677278 missense probably benign
IGL00571:Hmcn1 APN 1 150638999 missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150806366 critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150664936 missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150656734 missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150630340 missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150610713 missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150605006 missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150582301 missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150638869 missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150627033 missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150632552 splice site probably benign
IGL01304:Hmcn1 APN 1 150622924 missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150745001 missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150719240 missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150593097 missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150859239 missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150605072 missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150609631 missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150598397 missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150627413 missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150672032 missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150580233 missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150737299 missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150583280 missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150744960 missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150672038 missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150615300 missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150690601 missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150742260 splice site probably benign
IGL01906:Hmcn1 APN 1 150667887 missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150732892 missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150603871 missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150615298 missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150704181 missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150630728 missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150722607 missense probably benign
IGL02155:Hmcn1 APN 1 150563598 missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150806401 missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150664915 missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150802897 missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150722424 missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150993023 missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150809726 missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150697493 missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150744995 missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150619009 missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150604903 missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150656694 nonsense probably null
IGL02735:Hmcn1 APN 1 150646832 missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150563828 missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150675974 critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150577278 missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150657207 missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150697522 missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150671917 missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150808539 missense probably benign
IGL03195:Hmcn1 APN 1 150802909 missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150743667 missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150770352 splice site probably benign
IGL03268:Hmcn1 APN 1 150772510 missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150598424 missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150630231 missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150732910 missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150701969 missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150663872 missense probably damaging 1.00
backbone UTSW 1 150622994 missense probably benign 0.09
cambrian UTSW 1 150732846 missense probably damaging 1.00
chordate UTSW 1 150587015 missense probably benign 0.00
lancelet UTSW 1 150675540 missense probably benign 0.00
notochord UTSW 1 150770293 missense probably benign 0.00
IGL02991:Hmcn1 UTSW 1 150738658 missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150720689 missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150808737 missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150669487 missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150808676 missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150652551 missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150677406 missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150587015 missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150808647 missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150677324 missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150663879 missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150603811 missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150798814 missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150715822 missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150732792 splice site probably benign
R0503:Hmcn1 UTSW 1 150859252 missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150876419 splice site probably benign
R0506:Hmcn1 UTSW 1 150742341 missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150719117 missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150650017 nonsense probably null
R0599:Hmcn1 UTSW 1 150609801 missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150657376 critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150594016 missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150798719 splice site probably null
R0699:Hmcn1 UTSW 1 150819410 missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150808787 missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150753665 missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150650073 missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150679607 splice site probably null
R0975:Hmcn1 UTSW 1 150577377 missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1233:Hmcn1 UTSW 1 150749026 missense probably benign
R1234:Hmcn1 UTSW 1 150753654 nonsense probably null
R1291:Hmcn1 UTSW 1 150748191 missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150680715 missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150646794 missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150652506 splice site probably benign
R1458:Hmcn1 UTSW 1 150609700 missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150772552 missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150669421 missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150773803 missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150734532 missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150657241 missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150745027 missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150669558 missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150630333 missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150565369 nonsense probably null
R1710:Hmcn1 UTSW 1 150675984 missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150859186 missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150599030 missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150563568 missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150749083 missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150598285 missense probably benign 0.00
R1794:Hmcn1 UTSW 1 150627152 missense probably damaging 0.98
R1856:Hmcn1 UTSW 1 150721664 missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150657193 missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150603812 missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150720695 missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150577295 missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150657451 missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150992855 missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150604882 missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150649676 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150675991 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150677376 missense possibly damaging 0.72
R2001:Hmcn1 UTSW 1 150738613 missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150677334 missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150577323 missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150633659 missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150715815 missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150599010 missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150624598 splice site probably benign
R2303:Hmcn1 UTSW 1 150704226 missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150652678 splice site probably benign
R2338:Hmcn1 UTSW 1 150622934 missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150565384 missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150860341 missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150599032 missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150615221 missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150686867 nonsense probably null
R2519:Hmcn1 UTSW 1 150773820 nonsense probably null
R2520:Hmcn1 UTSW 1 150743647 missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150652575 missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150630652 critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150563599 nonsense probably null
R2849:Hmcn1 UTSW 1 150563599 nonsense probably null
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150802873 missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150749035 missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150689518 missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150745025 missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150802824 missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150622994 missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150586418 missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150649577 critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150586965 missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150690610 missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150573569 missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150722453 missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150722369 missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150772502 missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150658508 missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150595999 splice site probably null
R4441:Hmcn1 UTSW 1 150657459 missense probably null
R4493:Hmcn1 UTSW 1 150701899 missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150633666 missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150563780 missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150734487 missense probably benign
R4601:Hmcn1 UTSW 1 150738645 missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150595894 missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150675511 critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150624550 missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150619065 missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150772571 splice site probably null
R4724:Hmcn1 UTSW 1 150694833 splice site probably null
R4737:Hmcn1 UTSW 1 150689595 missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150577612 missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150593085 missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150677379 missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150722535 missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150876360 intron probably benign
R4968:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150819449 missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150680688 missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150588257 missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150737256 missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150610669 missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150656741 missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150646701 missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150595861 missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150679514 missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150582296 missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150755372 missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150623244 missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150701972 missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150675540 missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150609825 splice site probably null
R5531:Hmcn1 UTSW 1 150743788 missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150755291 missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150737506 missense possibly damaging 0.64
R5626:Hmcn1 UTSW 1 150656567 missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150658562 missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150609778 missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150609666 missense probably damaging 1.00
R5718:Hmcn1 UTSW 1 150690600 nonsense probably null
R5723:Hmcn1 UTSW 1 150694849 missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150758474 splice site probably null
R5739:Hmcn1 UTSW 1 150808697 missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150573554 missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150694878 missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150674347 nonsense probably null
R5809:Hmcn1 UTSW 1 150649607 missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150737524 missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150993023 missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150630327 missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150598897 missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150577296 nonsense probably null
R5940:Hmcn1 UTSW 1 150657222 missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150563817 missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150704173 missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150802895 missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150632437 missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150663909 missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150770330 missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150755293 missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150755294 missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150631227 missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150618936 missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150732846 missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150722424 missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150565425 missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150646784 missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150615438 intron probably null
R6187:Hmcn1 UTSW 1 150630728 missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150738681 missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150697419 critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150697476 missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150744960 missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150992919 missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150664784 missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150677302 nonsense probably null
R6490:Hmcn1 UTSW 1 150583278 missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150697566 missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150615438 intron probably null
R6612:Hmcn1 UTSW 1 150595118 critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150723257 critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150743796 missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150758306 missense probably benign
R6687:Hmcn1 UTSW 1 150745033 missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150704175 missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150734518 missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150770293 missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150993051 start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150599653 critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150773890 missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150604102 missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150860367 missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150604246 missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150700541 missense probably damaging 0.98
R7144:Hmcn1 UTSW 1 150663873 missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150686854 missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150748993 missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150753699 missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150649580 missense probably null 1.00
R7231:Hmcn1 UTSW 1 150638876 missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150722643 missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150715823 missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150582337 missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150683715 missense possibly damaging 0.52
R7316:Hmcn1 UTSW 1 150732946 missense probably damaging 1.00
X0022:Hmcn1 UTSW 1 150700530 missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150860376 missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150663901 missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150648937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGATGCTCTGCTGTTCCTATAC -3'
(R):5'- TGGCATCACTGTTGGAGAGG -3'

Sequencing Primer
(F):5'- CTGTTCCTATACTCTGAGTAGGAGC -3'
(R):5'- GGATGTCTTTACTTTGTTTCACAGAC -3'
Posted On2016-10-26