Incidental Mutation 'R5580:Itih2'
ID438355
Institutional Source Beutler Lab
Gene Symbol Itih2
Ensembl Gene ENSMUSG00000037254
Gene Nameinter-alpha trypsin inhibitor, heavy chain 2
SynonymsItih-2, Intin2
MMRRC Submission 043134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5580 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location10094593-10131396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10123476 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 138 (E138G)
Ref Sequence ENSEMBL: ENSMUSP00000124636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290] [ENSMUST00000155809] [ENSMUST00000161909]
Predicted Effect probably damaging
Transcript: ENSMUST00000042290
AA Change: E138G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254
AA Change: E138G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155809
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124636
Gene: ENSMUSG00000037254
AA Change: E138G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 452 4.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161909
SMART Domains Protein: ENSMUSP00000124880
Gene: ENSMUSG00000037254

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:VIT 60 81 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Gnl3 T C 14: 31,015,285 K212R probably benign Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hmcn1 G A 1: 150,577,539 P5342S probably benign Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Muc5b A G 7: 141,861,347 T2677A possibly damaging Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pi4ka A G 16: 17,281,087 S1978P probably damaging Het
Pik3c2g A T 6: 139,626,533 Q239L probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Syngap1 G A 17: 26,962,331 A9T probably damaging Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Itih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Itih2 APN 2 10110439 missense probably benign 0.00
IGL01775:Itih2 APN 2 10129286 missense probably benign 0.19
IGL02516:Itih2 APN 2 10097917 missense probably benign 0.00
IGL02698:Itih2 APN 2 10130501 missense probably damaging 1.00
IGL02747:Itih2 APN 2 10097945 missense probably benign 0.35
IGL03162:Itih2 APN 2 10126244 missense probably damaging 1.00
IGL03325:Itih2 APN 2 10106735 missense probably damaging 1.00
R0226:Itih2 UTSW 2 10115299 missense possibly damaging 0.71
R0316:Itih2 UTSW 2 10105246 missense possibly damaging 0.67
R0415:Itih2 UTSW 2 10105615 unclassified probably benign
R0612:Itih2 UTSW 2 10117394 missense probably benign 0.16
R0625:Itih2 UTSW 2 10123414 missense possibly damaging 0.49
R0766:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1312:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1322:Itih2 UTSW 2 10109522 missense probably damaging 1.00
R1521:Itih2 UTSW 2 10106747 missense probably damaging 1.00
R1544:Itih2 UTSW 2 10105214 missense probably benign 0.27
R1622:Itih2 UTSW 2 10102079 missense probably benign 0.00
R1649:Itih2 UTSW 2 10105735 missense probably benign 0.37
R2064:Itih2 UTSW 2 10130574 missense possibly damaging 0.83
R2378:Itih2 UTSW 2 10094887 missense probably damaging 1.00
R2893:Itih2 UTSW 2 10102197 missense possibly damaging 0.79
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3733:Itih2 UTSW 2 10105670 missense probably benign 0.00
R4195:Itih2 UTSW 2 10115285 missense probably damaging 1.00
R4405:Itih2 UTSW 2 10106737 nonsense probably null
R4585:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4586:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4610:Itih2 UTSW 2 10105160 missense probably damaging 0.96
R5311:Itih2 UTSW 2 10110535 missense probably benign 0.01
R5361:Itih2 UTSW 2 10096461 missense probably benign 0.09
R5436:Itih2 UTSW 2 10105196 missense probably benign 0.00
R5454:Itih2 UTSW 2 10097993 missense probably null 0.00
R5621:Itih2 UTSW 2 10102805 missense probably benign 0.00
R5846:Itih2 UTSW 2 10097903 missense probably benign 0.00
R6083:Itih2 UTSW 2 10108894 intron probably benign
R6190:Itih2 UTSW 2 10098507 missense probably benign 0.37
R6198:Itih2 UTSW 2 10098541 missense probably benign 0.00
R6469:Itih2 UTSW 2 10123413 missense possibly damaging 0.65
R6816:Itih2 UTSW 2 10105706 missense probably damaging 1.00
R6820:Itih2 UTSW 2 10098098 missense probably benign 0.00
R6853:Itih2 UTSW 2 10115266 missense probably damaging 1.00
R7102:Itih2 UTSW 2 10105763 missense probably benign 0.27
R7173:Itih2 UTSW 2 10105163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTGTCCATTTTCCGAGGC -3'
(R):5'- TACAGTCAGACAAGAGAGTCTTCTC -3'

Sequencing Primer
(F):5'- ATTTTCCGAGGCTCCCAGACAC -3'
(R):5'- AATTATTCAAAGATCACTTGTCTCGC -3'
Posted On2016-10-26