Incidental Mutation 'R5580:Muc5b'
ID438398
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Namemucin 5, subtype B, tracheobronchial
SynonymsMUC5, MUC9, 2300002I04Rik
MMRRC Submission 043134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5580 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141839070-141873084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141861347 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2677 (T2677A)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165147
AA Change: T2677A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: T2677A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Gnl3 T C 14: 31,015,285 K212R probably benign Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hmcn1 G A 1: 150,577,539 P5342S probably benign Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Itih2 T C 2: 10,123,476 E138G probably damaging Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pi4ka A G 16: 17,281,087 S1978P probably damaging Het
Pik3c2g A T 6: 139,626,533 Q239L probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Syngap1 G A 17: 26,962,331 A9T probably damaging Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141841392 missense unknown
IGL00677:Muc5b APN 7 141857894 nonsense probably null
IGL00740:Muc5b APN 7 141855598 missense unknown
IGL01084:Muc5b APN 7 141843449 splice site probably benign
IGL01384:Muc5b APN 7 141846818 missense unknown
IGL01447:Muc5b APN 7 141863094 missense probably benign 0.01
IGL01510:Muc5b APN 7 141859061 missense unknown
IGL01532:Muc5b APN 7 141870006 missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141863240 missense probably benign 0.01
IGL01608:Muc5b APN 7 141846437 missense unknown
IGL01884:Muc5b APN 7 141868083 splice site probably benign
IGL01943:Muc5b APN 7 141861497 missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141871164 missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141863250 missense probably benign 0.04
IGL02110:Muc5b APN 7 141847716 nonsense probably null
IGL02123:Muc5b APN 7 141863757 missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141855632 missense unknown
IGL02141:Muc5b APN 7 141853367 missense unknown
IGL02409:Muc5b APN 7 141861338 missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141868489 missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141867667 missense probably benign 0.33
IGL02504:Muc5b APN 7 141846440 missense unknown
IGL02528:Muc5b APN 7 141864017 missense probably benign 0.01
IGL02534:Muc5b APN 7 141844719 missense unknown
IGL02565:Muc5b APN 7 141857867 missense unknown
IGL02630:Muc5b APN 7 141863231 missense probably benign 0.03
IGL02881:Muc5b APN 7 141857712 missense unknown
IGL02963:Muc5b APN 7 141864264 missense probably damaging 1.00
IGL03003:Muc5b APN 7 141863614 missense probably benign 0.03
IGL03013:Muc5b APN 7 141863928 missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141863069 missense probably benign 0.35
IGL03114:Muc5b APN 7 141858819 nonsense probably null
IGL03150:Muc5b APN 7 141865509 missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141862822 missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141841380 missense unknown
IGL03336:Muc5b APN 7 141864363 missense probably damaging 1.00
IGL03370:Muc5b APN 7 141864777 missense probably benign 0.34
IGL03375:Muc5b APN 7 141861962 missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141864138 missense probably benign 0.21
profligate UTSW 7 141857822 nonsense probably null
wasteful UTSW 7 141858161 missense unknown
R0045:Muc5b UTSW 7 141856818 missense unknown
R0256:Muc5b UTSW 7 141841395 missense unknown
R0256:Muc5b UTSW 7 141843258 missense unknown
R0321:Muc5b UTSW 7 141862235 missense probably benign 0.19
R0391:Muc5b UTSW 7 141865082 missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141864972 missense probably benign 0.20
R0491:Muc5b UTSW 7 141862015 missense probably benign 0.01
R0543:Muc5b UTSW 7 141851785 missense unknown
R0583:Muc5b UTSW 7 141856698 nonsense probably null
R0611:Muc5b UTSW 7 141862436 missense probably benign 0.18
R0625:Muc5b UTSW 7 141846427 missense unknown
R0655:Muc5b UTSW 7 141863942 missense probably benign 0.01
R0845:Muc5b UTSW 7 141850446 splice site probably null
R0863:Muc5b UTSW 7 141867717 missense probably benign 0.18
R0965:Muc5b UTSW 7 141863802 missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141871795 missense probably benign 0.03
R1140:Muc5b UTSW 7 141858996 missense unknown
R1209:Muc5b UTSW 7 141857910 missense unknown
R1333:Muc5b UTSW 7 141868407 missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141858624 missense unknown
R1385:Muc5b UTSW 7 141862137 missense probably benign 0.00
R1463:Muc5b UTSW 7 141859080 missense unknown
R1471:Muc5b UTSW 7 141843234 missense unknown
R1617:Muc5b UTSW 7 141863524 nonsense probably null
R1736:Muc5b UTSW 7 141859107 missense unknown
R1752:Muc5b UTSW 7 141867751 missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141863780 missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141865493 missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141857645 missense unknown
R1902:Muc5b UTSW 7 141864105 missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141846031 missense unknown
R1924:Muc5b UTSW 7 141868223 missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141857684 missense unknown
R1959:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1960:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141863154 missense probably benign 0.01
R2080:Muc5b UTSW 7 141869754 missense probably benign 0.33
R2178:Muc5b UTSW 7 141864116 missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141858864 nonsense probably null
R2229:Muc5b UTSW 7 141861644 missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141862089 missense probably benign 0.00
R2509:Muc5b UTSW 7 141859061 missense unknown
R2510:Muc5b UTSW 7 141859061 missense unknown
R2512:Muc5b UTSW 7 141859076 missense unknown
R2888:Muc5b UTSW 7 141861554 missense probably damaging 0.98
R3054:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3055:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3108:Muc5b UTSW 7 141858759 missense unknown
R3109:Muc5b UTSW 7 141858759 missense unknown
R3113:Muc5b UTSW 7 141846134 missense unknown
R3551:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141867705 missense probably benign 0.18
R3622:Muc5b UTSW 7 141851858 splice site probably benign
R3700:Muc5b UTSW 7 141847249 missense unknown
R3734:Muc5b UTSW 7 141859037 nonsense probably null
R3785:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141863834 missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141864126 missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141859181 missense unknown
R3835:Muc5b UTSW 7 141859181 missense unknown
R3850:Muc5b UTSW 7 141862638 missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141857552 missense unknown
R3909:Muc5b UTSW 7 141849498 missense unknown
R3964:Muc5b UTSW 7 141866968 missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4015:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4017:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4042:Muc5b UTSW 7 141864887 missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141858925 nonsense probably null
R4230:Muc5b UTSW 7 141863522 missense probably benign 0.03
R4400:Muc5b UTSW 7 141861387 missense possibly damaging 0.92
R4455:Muc5b UTSW 7 141858818 missense unknown
R4484:Muc5b UTSW 7 141868450 missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141857984 missense unknown
R4646:Muc5b UTSW 7 141862640 missense probably benign 0.34
R4658:Muc5b UTSW 7 141841398 missense unknown
R4667:Muc5b UTSW 7 141842379 missense unknown
R4690:Muc5b UTSW 7 141842294 missense unknown
R4697:Muc5b UTSW 7 141857361 missense unknown
R4711:Muc5b UTSW 7 141846033 missense unknown
R4713:Muc5b UTSW 7 141849079 nonsense probably null
R4749:Muc5b UTSW 7 141861448 nonsense probably null
R4753:Muc5b UTSW 7 141856853 missense unknown
R4782:Muc5b UTSW 7 141847716 nonsense probably null
R4795:Muc5b UTSW 7 141849567 missense unknown
R4796:Muc5b UTSW 7 141864246 missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141847716 nonsense probably null
R4824:Muc5b UTSW 7 141864185 missense probably damaging 1.00
R4825:Muc5b UTSW 7 141868465 missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141858608 missense unknown
R5073:Muc5b UTSW 7 141859262 missense unknown
R5074:Muc5b UTSW 7 141859262 missense unknown
R5107:Muc5b UTSW 7 141855531 missense unknown
R5152:Muc5b UTSW 7 141865531 missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141850810 missense unknown
R5191:Muc5b UTSW 7 141858539 missense unknown
R5254:Muc5b UTSW 7 141864540 missense probably benign 0.09
R5320:Muc5b UTSW 7 141859001 missense unknown
R5352:Muc5b UTSW 7 141864558 missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141862203 missense unknown
R5417:Muc5b UTSW 7 141858044 missense unknown
R5548:Muc5b UTSW 7 141863942 missense probably benign 0.01
R5551:Muc5b UTSW 7 141868503 missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141847238 missense unknown
R5629:Muc5b UTSW 7 141861299 missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141858983 missense unknown
R5783:Muc5b UTSW 7 141858428 nonsense probably null
R5795:Muc5b UTSW 7 141871741 missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141857396 missense unknown
R5797:Muc5b UTSW 7 141851582 missense unknown
R5806:Muc5b UTSW 7 141862835 missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141858421 missense unknown
R5910:Muc5b UTSW 7 141861311 missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141864173 missense probably damaging 0.99
R5970:Muc5b UTSW 7 141856712 missense unknown
R5990:Muc5b UTSW 7 141858161 missense unknown
R5999:Muc5b UTSW 7 141857379 missense unknown
R6001:Muc5b UTSW 7 141872381 missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141864708 missense probably benign 0.07
R6073:Muc5b UTSW 7 141849060 missense unknown
R6073:Muc5b UTSW 7 141858288 missense unknown
R6112:Muc5b UTSW 7 141863305 missense probably benign 0.01
R6153:Muc5b UTSW 7 141861444 missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141863345 missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141858776 missense unknown
R6178:Muc5b UTSW 7 141856342 missense probably null
R6196:Muc5b UTSW 7 141851596 missense unknown
R6213:Muc5b UTSW 7 141862166 missense probably benign 0.00
R6213:Muc5b UTSW 7 141867619 missense possibly damaging 0.92
R6344:Muc5b UTSW 7 141862971 missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141858665 missense unknown
R6414:Muc5b UTSW 7 141859097 missense unknown
R6521:Muc5b UTSW 7 141859171 nonsense probably null
R6658:Muc5b UTSW 7 141868507 critical splice donor site probably null
R6717:Muc5b UTSW 7 141857822 nonsense probably null
R6737:Muc5b UTSW 7 141857499 missense unknown
R6763:Muc5b UTSW 7 141862284 missense probably benign 0.01
R6817:Muc5b UTSW 7 141862913 missense probably benign 0.06
R6819:Muc5b UTSW 7 141858863 missense unknown
R6916:Muc5b UTSW 7 141864717 missense possibly damaging 0.71
R7030:Muc5b UTSW 7 141842455 missense unknown
R7116:Muc5b UTSW 7 141863750 missense probably benign 0.10
R7134:Muc5b UTSW 7 141857654 missense unknown
R7146:Muc5b UTSW 7 141863967 missense possibly damaging 0.96
R7168:Muc5b UTSW 7 141864017 missense probably benign 0.01
R7182:Muc5b UTSW 7 141842645 missense unknown
R7189:Muc5b UTSW 7 141861061 nonsense probably null
R7207:Muc5b UTSW 7 141862865 missense probably benign 0.01
R7232:Muc5b UTSW 7 141866129 missense possibly damaging 0.53
R7260:Muc5b UTSW 7 141842648 missense unknown
R7269:Muc5b UTSW 7 141857535 missense unknown
R7273:Muc5b UTSW 7 141851570 missense unknown
R7307:Muc5b UTSW 7 141842294 missense unknown
R7323:Muc5b UTSW 7 141858707 missense unknown
Z1088:Muc5b UTSW 7 141862214 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACATACTTCCTGGCCTGC -3'
(R):5'- TACAGATGAGTCCAAAGTCCAC -3'

Sequencing Primer
(F):5'- CGTCCAGCATGCCTACCAG -3'
(R):5'- GATGAGTCCAAAGTCCACATTAC -3'
Posted On2016-10-26