Incidental Mutation 'R5580:Gnl3'
ID438431
Institutional Source Beutler Lab
Gene Symbol Gnl3
Ensembl Gene ENSMUSG00000042354
Gene Nameguanine nucleotide binding protein-like 3 (nucleolar)
Synonymsnucleostemin, NS
MMRRC Submission 043134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5580 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31012433-31019152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31015285 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 212 (K212R)
Ref Sequence ENSEMBL: ENSMUSP00000047119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022476] [ENSMUST00000037739] [ENSMUST00000052239] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000112106] [ENSMUST00000144009] [ENSMUST00000146325] [ENSMUST00000168584] [ENSMUST00000226740] [ENSMUST00000227467] [ENSMUST00000228341]
Predicted Effect probably benign
Transcript: ENSMUST00000022476
SMART Domains Protein: ENSMUSP00000022476
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037739
AA Change: K212R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047119
Gene: ENSMUSG00000042354
AA Change: K212R

DomainStartEndE-ValueType
Pfam:GN3L_Grn1 16 90 4.3e-25 PFAM
low complexity region 112 126 N/A INTRINSIC
SCOP:d1egaa1 130 207 3e-3 SMART
low complexity region 209 220 N/A INTRINSIC
Pfam:MMR_HSR1 251 362 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052239
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104609
Predicted Effect probably benign
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112106
SMART Domains Protein: ENSMUSP00000107734
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 61 91 6e-16 BLAST
PDB:3IU5|A 61 91 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000144009
SMART Domains Protein: ENSMUSP00000123518
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 40 68 8e-14 BLAST
PDB:3IU5|A 64 84 8e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145497
Predicted Effect probably benign
Transcript: ENSMUST00000146325
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157287
Predicted Effect probably benign
Transcript: ENSMUST00000168584
SMART Domains Protein: ENSMUSP00000129323
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 8.6e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226348
Predicted Effect probably benign
Transcript: ENSMUST00000226379
Predicted Effect probably benign
Transcript: ENSMUST00000226740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227389
Predicted Effect probably benign
Transcript: ENSMUST00000227467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228255
Predicted Effect probably benign
Transcript: ENSMUST00000228341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228774
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene leads to early embryonic loss as blastocysts fail to enter the S phase. MEFs heterozygous for a gene trap allele have reduced proliferative capacity while MEFs heterozygous for a null allele show reduced doubling rates,increased apoptosis and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hmcn1 G A 1: 150,577,539 P5342S probably benign Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Itih2 T C 2: 10,123,476 E138G probably damaging Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Muc5b A G 7: 141,861,347 T2677A possibly damaging Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pi4ka A G 16: 17,281,087 S1978P probably damaging Het
Pik3c2g A T 6: 139,626,533 Q239L probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Syngap1 G A 17: 26,962,331 A9T probably damaging Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Gnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Gnl3 APN 14 31014189 missense possibly damaging 0.71
IGL00826:Gnl3 APN 14 31012796 unclassified probably benign
IGL02323:Gnl3 APN 14 31017402 missense probably damaging 1.00
R0277:Gnl3 UTSW 14 31013427 critical splice donor site probably null
R0636:Gnl3 UTSW 14 31017153 missense probably damaging 1.00
R0727:Gnl3 UTSW 14 31017077 missense probably damaging 0.99
R1459:Gnl3 UTSW 14 31017846 missense probably damaging 1.00
R1474:Gnl3 UTSW 14 31016461 splice site probably benign
R2016:Gnl3 UTSW 14 31016369 unclassified probably null
R2352:Gnl3 UTSW 14 31016826 critical splice donor site probably null
R2517:Gnl3 UTSW 14 31014163 missense probably damaging 1.00
R4115:Gnl3 UTSW 14 31016856 missense probably damaging 1.00
R4697:Gnl3 UTSW 14 31017329 missense probably damaging 0.98
R4853:Gnl3 UTSW 14 31015313 missense probably damaging 0.99
R4973:Gnl3 UTSW 14 31013505 missense possibly damaging 0.68
R5091:Gnl3 UTSW 14 31016846 missense possibly damaging 0.76
R5914:Gnl3 UTSW 14 31016896 missense possibly damaging 0.85
R6898:Gnl3 UTSW 14 31013179 missense probably benign 0.01
R7292:Gnl3 UTSW 14 31013232 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAACATCACCAGGTGGAATAC -3'
(R):5'- CTCTCAAAACATTGGGGAAGTACAG -3'

Sequencing Primer
(F):5'- GAGTCCAGCTTTCAGAAAAACTGCTG -3'
(R):5'- TTGGGGAAGTACAGATTAGTAAGATC -3'
Posted On2016-10-26