Incidental Mutation 'R5580:Pi4ka'
ID438438
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 043134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5580 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17281087 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1978 (S1978P)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000069420] [ENSMUST00000154364] [ENSMUST00000159065] [ENSMUST00000159242] [ENSMUST00000159494] [ENSMUST00000159811] [ENSMUST00000161775] [ENSMUST00000162085] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]
Predicted Effect probably damaging
Transcript: ENSMUST00000036161
AA Change: S1978P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: S1978P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069420
SMART Domains Protein: ENSMUSP00000068902
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148110
Predicted Effect probably damaging
Transcript: ENSMUST00000154364
AA Change: S1978P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: S1978P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123156
Gene: ENSMUSG00000041720
AA Change: S143P

DomainStartEndE-ValueType
PI3Kc 57 207 1.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159065
SMART Domains Protein: ENSMUSP00000123791
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159242
SMART Domains Protein: ENSMUSP00000124757
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159494
Predicted Effect probably benign
Transcript: ENSMUST00000159811
SMART Domains Protein: ENSMUSP00000123710
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160949
Predicted Effect probably benign
Transcript: ENSMUST00000161775
SMART Domains Protein: ENSMUSP00000123917
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 121 3.1e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161897
Predicted Effect probably benign
Transcript: ENSMUST00000162085
SMART Domains Protein: ENSMUSP00000124217
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
Pfam:TMEM191C 1 59 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162522
Predicted Effect probably benign
Transcript: ENSMUST00000164950
SMART Domains Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
coiled coil region 5 112 N/A INTRINSIC
Pfam:TMEM191C 182 302 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232092
Predicted Effect probably benign
Transcript: ENSMUST00000232167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232220
Predicted Effect probably damaging
Transcript: ENSMUST00000232232
AA Change: S1978P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000232364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232636
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Gnl3 T C 14: 31,015,285 K212R probably benign Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hmcn1 G A 1: 150,577,539 P5342S probably benign Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Itih2 T C 2: 10,123,476 E138G probably damaging Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Muc5b A G 7: 141,861,347 T2677A possibly damaging Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pik3c2g A T 6: 139,626,533 Q239L probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Syngap1 G A 17: 26,962,331 A9T probably damaging Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTATGCTCCCTGATCCTCG -3'
(R):5'- AGAGCATCTTTGAAACCCCTG -3'

Sequencing Primer
(F):5'- TGATCCTCGCCAGCAATTACTAGG -3'
(R):5'- TTTGAAACCCCTGCTGGAAG -3'
Posted On2016-10-26