Incidental Mutation 'R5580:Syngap1'
ID438442
Institutional Source Beutler Lab
Gene Symbol Syngap1
Ensembl Gene ENSMUSG00000067629
Gene Namesynaptic Ras GTPase activating protein 1 homolog (rat)
SynonymsSyngap
MMRRC Submission 043134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5580 (G1)
Quality Score213
Status Not validated
Chromosome17
Chromosomal Location26941253-26972434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26962331 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 9 (A9T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000202939] [ENSMUST00000228963] [ENSMUST00000229490] [ENSMUST00000231853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081285
AA Change: A1019T

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629
AA Change: A1019T

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177932
AA Change: A1078T

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629
AA Change: A1078T

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
AA Change: A1062T

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629
AA Change: A1062T

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194598
AA Change: A1078T

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629
AA Change: A1078T

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200799
Predicted Effect probably damaging
Transcript: ENSMUST00000201186
AA Change: A9T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect unknown
Transcript: ENSMUST00000201349
AA Change: A1077T
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629
AA Change: A1077T

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201702
AA Change: A1064T
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629
AA Change: A1064T

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect probably benign
Transcript: ENSMUST00000202939
SMART Domains Protein: ENSMUSP00000144403
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
Pfam:RasGAP 1 61 5.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228963
AA Change: A1019T

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000229490
AA Change: A1078T

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231853
AA Change: A905T

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Homozygous null mutations result in early post-embryonic lethality, while heterozygous mutant mice display a variety of phenotypes that include learning and memory defects, hyperactivity, and audiogenic seizures. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, and by P3-P4, exhibit small body size and brain, reduced movement and do not feed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Gnl3 T C 14: 31,015,285 K212R probably benign Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hmcn1 G A 1: 150,577,539 P5342S probably benign Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Itih2 T C 2: 10,123,476 E138G probably damaging Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Muc5b A G 7: 141,861,347 T2677A possibly damaging Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pi4ka A G 16: 17,281,087 S1978P probably damaging Het
Pik3c2g A T 6: 139,626,533 Q239L probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Syngap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0732:Syngap1 UTSW 17 26954988 missense possibly damaging 0.94
R1178:Syngap1 UTSW 17 26957805 missense probably damaging 0.99
R1680:Syngap1 UTSW 17 26952579 missense possibly damaging 0.60
R1953:Syngap1 UTSW 17 26944687 missense possibly damaging 0.94
R2213:Syngap1 UTSW 17 26953069 missense probably damaging 1.00
R2696:Syngap1 UTSW 17 26957411 nonsense probably null
R2899:Syngap1 UTSW 17 26959985 missense probably damaging 1.00
R3237:Syngap1 UTSW 17 26957093 nonsense probably null
R3705:Syngap1 UTSW 17 26960020 missense probably damaging 1.00
R3880:Syngap1 UTSW 17 26953064 missense probably damaging 1.00
R4019:Syngap1 UTSW 17 26952341 unclassified probably benign
R4661:Syngap1 UTSW 17 26966906 missense probably damaging 1.00
R4798:Syngap1 UTSW 17 26961449 missense probably benign 0.00
R5524:Syngap1 UTSW 17 26957152 missense probably damaging 1.00
R5610:Syngap1 UTSW 17 26959780 missense possibly damaging 0.68
R5835:Syngap1 UTSW 17 26958218 missense probably benign 0.09
R5974:Syngap1 UTSW 17 26963038 missense probably damaging 0.98
R6235:Syngap1 UTSW 17 26958130 missense probably benign 0.00
R6247:Syngap1 UTSW 17 26962957 nonsense probably null
R6461:Syngap1 UTSW 17 26964848 missense probably damaging 1.00
R6503:Syngap1 UTSW 17 26944684 missense probably benign 0.40
R7134:Syngap1 UTSW 17 26960011 missense probably damaging 1.00
R7248:Syngap1 UTSW 17 26957767 missense probably damaging 1.00
R7298:Syngap1 UTSW 17 26962987 missense possibly damaging 0.85
X0017:Syngap1 UTSW 17 26944651 missense probably benign 0.11
Z1088:Syngap1 UTSW 17 26961576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCGCTTCAGGACAGTCTAC -3'
(R):5'- ACCAGACTACACTGTTGCTTCC -3'

Sequencing Primer
(F):5'- TTCAGGACAGTCTACAGCACATG -3'
(R):5'- GACTACACTGTTGCTTCCCTCCC -3'
Posted On2016-10-26