Incidental Mutation 'R5581:Ptpn12'
ID 438460
Institutional Source Beutler Lab
Gene Symbol Ptpn12
Ensembl Gene ENSMUSG00000028771
Gene Name protein tyrosine phosphatase, non-receptor type 12
Synonyms PTP-PEST, PTP-P19, P19-PTP
MMRRC Submission 043135-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5581 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 21191643-21260909 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21220724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 135 (E135D)
Ref Sequence ENSEMBL: ENSMUSP00000030556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813] [ENSMUST00000199774]
AlphaFold P35831
Predicted Effect probably damaging
Transcript: ENSMUST00000030556
AA Change: E135D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: E135D

DomainStartEndE-ValueType
PTPc 27 295 2.14e-126 SMART
Blast:PTPc 338 399 7e-12 BLAST
low complexity region 499 518 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140057
Predicted Effect probably benign
Transcript: ENSMUST00000151813
Predicted Effect probably benign
Transcript: ENSMUST00000199774
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G C 11: 85,100,921 (GRCm39) R173G possibly damaging Het
Bcl11a A G 11: 24,113,932 (GRCm39) K425R probably damaging Het
Casr A G 16: 36,315,106 (GRCm39) M911T probably benign Het
Cdon C T 9: 35,415,377 (GRCm39) A1205V probably benign Het
Chfr T C 5: 110,301,148 (GRCm39) probably null Het
Dixdc1 A G 9: 50,580,780 (GRCm39) L638P probably damaging Het
Filip1 C T 9: 79,727,042 (GRCm39) V526M possibly damaging Het
Fsip2 T A 2: 82,828,472 (GRCm39) D6756E possibly damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Lvrn A G 18: 47,023,932 (GRCm39) T760A probably benign Het
Myh7 T A 14: 55,216,411 (GRCm39) M1256L probably benign Het
Ndufb11b T C 15: 81,865,037 (GRCm39) S93P probably damaging Het
Or8g17 T A 9: 38,929,998 (GRCm39) I280F probably damaging Het
Pdia5 T C 16: 35,269,812 (GRCm39) R166G probably benign Het
Plcz1 A G 6: 139,968,851 (GRCm39) Y196H probably damaging Het
Rnh1 T C 7: 140,743,294 (GRCm39) D191G probably benign Het
Slit1 A G 19: 41,605,102 (GRCm39) probably null Het
Syne2 T G 12: 75,991,859 (GRCm39) D1941E probably benign Het
Thsd4 C A 9: 59,879,741 (GRCm39) A639S possibly damaging Het
Other mutations in Ptpn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ptpn12 APN 5 21,234,848 (GRCm39) missense probably damaging 1.00
IGL00226:Ptpn12 APN 5 21,203,666 (GRCm39) missense probably damaging 1.00
IGL01432:Ptpn12 APN 5 21,203,553 (GRCm39) nonsense probably null
IGL02285:Ptpn12 APN 5 21,260,711 (GRCm39) missense probably benign 0.40
IGL02488:Ptpn12 APN 5 21,227,060 (GRCm39) missense possibly damaging 0.72
IGL02550:Ptpn12 APN 5 21,203,137 (GRCm39) missense probably benign 0.00
IGL02640:Ptpn12 APN 5 21,224,244 (GRCm39) missense probably damaging 1.00
IGL02652:Ptpn12 APN 5 21,207,435 (GRCm39) missense probably benign 0.04
IGL03130:Ptpn12 APN 5 21,207,610 (GRCm39) unclassified probably benign
R0531:Ptpn12 UTSW 5 21,203,481 (GRCm39) missense possibly damaging 0.53
R0948:Ptpn12 UTSW 5 21,203,041 (GRCm39) missense probably benign
R1018:Ptpn12 UTSW 5 21,234,867 (GRCm39) missense possibly damaging 0.94
R1184:Ptpn12 UTSW 5 21,203,354 (GRCm39) missense possibly damaging 0.86
R1699:Ptpn12 UTSW 5 21,203,168 (GRCm39) missense probably benign 0.01
R1938:Ptpn12 UTSW 5 21,198,261 (GRCm39) missense probably damaging 1.00
R1952:Ptpn12 UTSW 5 21,203,308 (GRCm39) missense probably benign 0.34
R2152:Ptpn12 UTSW 5 21,207,466 (GRCm39) missense probably damaging 1.00
R2153:Ptpn12 UTSW 5 21,207,466 (GRCm39) missense probably damaging 1.00
R2154:Ptpn12 UTSW 5 21,207,466 (GRCm39) missense probably damaging 1.00
R2267:Ptpn12 UTSW 5 21,203,409 (GRCm39) missense probably damaging 0.98
R2358:Ptpn12 UTSW 5 21,203,690 (GRCm39) missense probably damaging 1.00
R3551:Ptpn12 UTSW 5 21,194,047 (GRCm39) missense possibly damaging 0.67
R3931:Ptpn12 UTSW 5 21,206,321 (GRCm39) missense probably benign 0.00
R4013:Ptpn12 UTSW 5 21,197,741 (GRCm39) missense probably benign 0.05
R4039:Ptpn12 UTSW 5 21,207,508 (GRCm39) nonsense probably null
R4501:Ptpn12 UTSW 5 21,224,278 (GRCm39) missense probably damaging 1.00
R4748:Ptpn12 UTSW 5 21,210,383 (GRCm39) nonsense probably null
R4754:Ptpn12 UTSW 5 21,203,587 (GRCm39) missense probably benign 0.34
R4963:Ptpn12 UTSW 5 21,220,706 (GRCm39) splice site probably null
R5160:Ptpn12 UTSW 5 21,202,829 (GRCm39) missense probably damaging 1.00
R5789:Ptpn12 UTSW 5 21,194,013 (GRCm39) missense possibly damaging 0.92
R5836:Ptpn12 UTSW 5 21,214,544 (GRCm39) nonsense probably null
R6383:Ptpn12 UTSW 5 21,192,466 (GRCm39) nonsense probably null
R6883:Ptpn12 UTSW 5 21,260,711 (GRCm39) missense probably benign 0.40
R7544:Ptpn12 UTSW 5 21,214,509 (GRCm39) missense probably damaging 1.00
R7885:Ptpn12 UTSW 5 21,203,523 (GRCm39) missense possibly damaging 0.54
R7915:Ptpn12 UTSW 5 21,214,449 (GRCm39) missense probably damaging 1.00
R7960:Ptpn12 UTSW 5 21,260,687 (GRCm39) missense probably benign 0.01
R7976:Ptpn12 UTSW 5 21,207,631 (GRCm39) nonsense probably null
R8032:Ptpn12 UTSW 5 21,203,041 (GRCm39) missense probably benign
R8224:Ptpn12 UTSW 5 21,203,656 (GRCm39) missense probably damaging 1.00
R8473:Ptpn12 UTSW 5 21,203,357 (GRCm39) missense probably benign 0.00
R8823:Ptpn12 UTSW 5 21,203,621 (GRCm39) missense probably damaging 1.00
R9375:Ptpn12 UTSW 5 21,224,212 (GRCm39) missense probably benign 0.21
R9613:Ptpn12 UTSW 5 21,203,621 (GRCm39) missense probably damaging 1.00
R9707:Ptpn12 UTSW 5 21,207,620 (GRCm39) missense probably damaging 0.99
X0004:Ptpn12 UTSW 5 21,224,294 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCACCAGAACTACTTTAATGTTCA -3'
(R):5'- TGAACCAGATTAGAGTTTAATCCAAAC -3'

Sequencing Primer
(F):5'- TGTTCAATTTTACTACC -3'
(R):5'- TGACATTTGTATTTCAC -3'
Posted On 2016-10-26