Incidental Mutation 'R5581:Casr'
ID 438477
Institutional Source Beutler Lab
Gene Symbol Casr
Ensembl Gene ENSMUSG00000051980
Gene Name calcium-sensing receptor
Synonyms CaR, cation sensing receptor, Gprc2a
MMRRC Submission 043135-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5581 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36314058-36382503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36315106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 911 (M911T)
Ref Sequence ENSEMBL: ENSMUSP00000110496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]
AlphaFold Q9QY96
Predicted Effect probably benign
Transcript: ENSMUST00000063597
AA Change: M988T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: M988T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 1e-13 PFAM
Pfam:ANF_receptor 69 495 1.1e-114 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 624 859 7.4e-61 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114847
AA Change: M911T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: M911T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.1e-14 PFAM
Pfam:ANF_receptor 69 461 2.8e-99 PFAM
Pfam:NCD3G 461 514 1.2e-20 PFAM
Pfam:7tm_3 545 783 9.9e-87 PFAM
low complexity region 817 843 N/A INTRINSIC
low complexity region 853 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172826
AA Change: M988T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: M988T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.4e-14 PFAM
Pfam:ANF_receptor 69 495 3.9e-111 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 622 860 1.1e-86 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G C 11: 85,100,921 (GRCm39) R173G possibly damaging Het
Bcl11a A G 11: 24,113,932 (GRCm39) K425R probably damaging Het
Cdon C T 9: 35,415,377 (GRCm39) A1205V probably benign Het
Chfr T C 5: 110,301,148 (GRCm39) probably null Het
Dixdc1 A G 9: 50,580,780 (GRCm39) L638P probably damaging Het
Filip1 C T 9: 79,727,042 (GRCm39) V526M possibly damaging Het
Fsip2 T A 2: 82,828,472 (GRCm39) D6756E possibly damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Lvrn A G 18: 47,023,932 (GRCm39) T760A probably benign Het
Myh7 T A 14: 55,216,411 (GRCm39) M1256L probably benign Het
Ndufb11b T C 15: 81,865,037 (GRCm39) S93P probably damaging Het
Or8g17 T A 9: 38,929,998 (GRCm39) I280F probably damaging Het
Pdia5 T C 16: 35,269,812 (GRCm39) R166G probably benign Het
Plcz1 A G 6: 139,968,851 (GRCm39) Y196H probably damaging Het
Ptpn12 T A 5: 21,220,724 (GRCm39) E135D probably damaging Het
Rnh1 T C 7: 140,743,294 (GRCm39) D191G probably benign Het
Slit1 A G 19: 41,605,102 (GRCm39) probably null Het
Syne2 T G 12: 75,991,859 (GRCm39) D1941E probably benign Het
Thsd4 C A 9: 59,879,741 (GRCm39) A639S possibly damaging Het
Other mutations in Casr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Casr APN 16 36,316,172 (GRCm39) missense probably damaging 1.00
IGL01587:Casr APN 16 36,330,127 (GRCm39) missense probably benign
IGL02323:Casr APN 16 36,330,072 (GRCm39) missense probably damaging 1.00
IGL02369:Casr APN 16 36,315,051 (GRCm39) missense probably benign 0.03
IGL02514:Casr APN 16 36,320,687 (GRCm39) missense probably damaging 1.00
IGL02547:Casr APN 16 36,336,036 (GRCm39) missense probably benign 0.06
IGL02633:Casr APN 16 36,336,017 (GRCm39) missense probably damaging 1.00
IGL03061:Casr APN 16 36,316,250 (GRCm39) missense probably benign 0.07
R1163:Casr UTSW 16 36,315,169 (GRCm39) missense probably damaging 1.00
R1539:Casr UTSW 16 36,315,499 (GRCm39) missense probably benign 0.10
R1643:Casr UTSW 16 36,320,567 (GRCm39) missense probably damaging 1.00
R1664:Casr UTSW 16 36,330,327 (GRCm39) nonsense probably null
R1694:Casr UTSW 16 36,315,953 (GRCm39) missense probably damaging 1.00
R2040:Casr UTSW 16 36,330,728 (GRCm39) missense possibly damaging 0.79
R2092:Casr UTSW 16 36,330,405 (GRCm39) missense possibly damaging 0.96
R2125:Casr UTSW 16 36,315,614 (GRCm39) missense possibly damaging 0.90
R2190:Casr UTSW 16 36,315,778 (GRCm39) missense probably damaging 1.00
R2214:Casr UTSW 16 36,336,120 (GRCm39) missense probably damaging 1.00
R4409:Casr UTSW 16 36,320,703 (GRCm39) missense probably benign 0.01
R4410:Casr UTSW 16 36,320,703 (GRCm39) missense probably benign 0.01
R4591:Casr UTSW 16 36,320,732 (GRCm39) missense probably benign 0.05
R5451:Casr UTSW 16 36,330,270 (GRCm39) missense probably damaging 0.99
R5469:Casr UTSW 16 36,330,392 (GRCm39) missense probably benign 0.29
R5700:Casr UTSW 16 36,329,979 (GRCm39) missense probably damaging 0.99
R6258:Casr UTSW 16 36,337,971 (GRCm39) missense probably damaging 1.00
R6447:Casr UTSW 16 36,315,907 (GRCm39) missense probably damaging 1.00
R6751:Casr UTSW 16 36,335,950 (GRCm39) missense probably benign 0.00
R6938:Casr UTSW 16 36,316,283 (GRCm39) missense probably damaging 1.00
R7063:Casr UTSW 16 36,314,936 (GRCm39) missense probably benign 0.00
R7313:Casr UTSW 16 36,330,033 (GRCm39) missense probably damaging 1.00
R7789:Casr UTSW 16 36,315,653 (GRCm39) missense probably damaging 1.00
R8013:Casr UTSW 16 36,330,006 (GRCm39) missense probably benign 0.22
R8026:Casr UTSW 16 36,315,979 (GRCm39) missense probably damaging 1.00
R8141:Casr UTSW 16 36,315,173 (GRCm39) missense probably damaging 1.00
R8184:Casr UTSW 16 36,330,108 (GRCm39) missense probably benign
R8278:Casr UTSW 16 36,336,011 (GRCm39) missense probably damaging 1.00
R8386:Casr UTSW 16 36,335,950 (GRCm39) missense probably damaging 0.96
R8393:Casr UTSW 16 36,330,566 (GRCm39) missense probably benign 0.02
R8682:Casr UTSW 16 36,315,784 (GRCm39) missense possibly damaging 0.65
R9020:Casr UTSW 16 36,315,611 (GRCm39) missense probably damaging 1.00
R9051:Casr UTSW 16 36,330,414 (GRCm39) missense probably benign 0.00
R9260:Casr UTSW 16 36,330,326 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGGACATTTCATCTGGGC -3'
(R):5'- ATGCTTTCAAAGTGGCAGCC -3'

Sequencing Primer
(F):5'- CATCTGGGCTTTCTATTTCTGGCTG -3'
(R):5'- AGGCTCCACTGGGTCGATTC -3'
Posted On 2016-10-26