Mutagenetix > Incidental Mutation

Incidental Mutation 'R5582:Ubr1'

438487

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

043136-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.833) question?

Stock #

R5582 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120690750-120801196 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120745888 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 849 (M849V)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: M849V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: M849V

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129790

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,586,639 (GRCm39)		probably null	Het
Agxt2	A	G	15: 10,399,245 (GRCm39)	D444G	probably damaging	Het
Aldh1b1	G	T	4: 45,802,750 (GRCm39)	R96L	probably damaging	Het
Ank2	T	C	3: 126,739,954 (GRCm39)		probably benign	Het
Apob	A	G	12: 8,060,788 (GRCm39)	Y3090C	probably damaging	Het
Bbx	A	G	16: 50,043,719 (GRCm39)	S647P	probably damaging	Het
Brinp2	T	C	1: 158,076,979 (GRCm39)	Y372C	probably damaging	Het
Btaf1	T	C	19: 36,965,573 (GRCm39)		probably null	Het
Cdk5rap1	T	A	2: 154,187,894 (GRCm39)	E477D	probably benign	Het
Cfap65	G	A	1: 74,946,677 (GRCm39)		probably benign	Het
Chdh	A	G	14: 29,758,816 (GRCm39)	Y587C	probably damaging	Het
Chek2	T	C	5: 111,015,901 (GRCm39)	V472A	probably damaging	Het
Clasrp	A	C	7: 19,320,781 (GRCm39)	I326S	probably damaging	Het
Clic6	A	T	16: 92,296,342 (GRCm39)	Q334L	possibly damaging	Het
Cyp2d11	A	T	15: 82,276,319 (GRCm39)		probably null	Het
Entpd7	T	C	19: 43,693,433 (GRCm39)	I171T	probably damaging	Het
Fosl1	T	C	19: 5,505,295 (GRCm39)		probably benign	Het
Gm6124	A	G	7: 38,869,622 (GRCm39)		noncoding transcript	Het
H3f3a	A	T	1: 180,637,650 (GRCm39)		probably benign	Het
Hs1bp3	AGAGGAGGAGGAGGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGGAGGAGGAGGAGG	12: 8,374,048 (GRCm39)		probably benign	Het
Idh2	CCAGGGC	CC	7: 79,748,087 (GRCm39)		probably null	Het
Igkv3-7	A	G	6: 70,584,990 (GRCm39)	Y110C	probably damaging	Het
Ints9	C	T	14: 65,266,345 (GRCm39)	T399M	possibly damaging	Het
Kctd19	G	A	8: 106,135,075 (GRCm39)	T62M	probably damaging	Het
Lsmem1	A	G	12: 40,230,643 (GRCm39)		probably null	Het
Obscn	T	C	11: 58,990,802 (GRCm39)		probably null	Het
Or11h23	T	C	14: 50,948,425 (GRCm39)	Y213H	probably damaging	Het
Or1j12	T	C	2: 36,343,233 (GRCm39)	I212T	probably benign	Het
Otop3	T	A	11: 115,230,165 (GRCm39)	M14K	unknown	Het
Pibf1	C	T	14: 99,374,566 (GRCm39)	A335V	possibly damaging	Het
Pkd1l2	A	T	8: 117,767,522 (GRCm39)	L1256*	probably null	Het
Plbd2	T	C	5: 120,631,171 (GRCm39)	E202G	probably benign	Het
Ppp1r37	A	G	7: 19,266,219 (GRCm39)	S516P	probably damaging	Het
Ppt2	G	A	17: 34,836,373 (GRCm39)	T229M	probably damaging	Het
Prr14	A	T	7: 127,075,569 (GRCm39)	I526F	probably damaging	Het
Scel	T	C	14: 103,820,575 (GRCm39)		probably benign	Het
Scn9a	A	T	2: 66,395,373 (GRCm39)		probably benign	Het
Senp6	T	A	9: 79,997,158 (GRCm39)	D57E	possibly damaging	Het
Setd5	T	C	6: 113,091,886 (GRCm39)	Y217H	probably damaging	Het
Sgcg	T	C	14: 61,462,754 (GRCm39)	T198A	probably damaging	Het
Sipa1	C	T	19: 5,704,729 (GRCm39)	G622D	probably benign	Het
Slc27a2	C	T	2: 126,406,610 (GRCm39)	A98V	probably damaging	Het
Slitrk3	G	T	3: 72,957,737 (GRCm39)	P345Q	probably benign	Het
Slx4	T	C	16: 3,803,652 (GRCm39)	D1054G	possibly damaging	Het
Sned1	A	T	1: 93,210,083 (GRCm39)	T898S	probably damaging	Het
Tg	C	T	15: 66,565,284 (GRCm39)	P1209S	probably damaging	Het
Tmem63b	C	A	17: 45,978,689 (GRCm39)	V294L	probably benign	Het
Tnks	G	A	8: 35,408,015 (GRCm39)	R238C	probably benign	Het
Tsn	G	A	1: 118,232,944 (GRCm39)	T120I	probably damaging	Het
Txnrd1	T	A	10: 82,731,814 (GRCm39)	F479I	possibly damaging	Het
Usp13	T	C	3: 32,965,738 (GRCm39)	S574P	probably damaging	Het
Vmn1r69	A	G	7: 10,314,435 (GRCm39)	Y20H	probably damaging	Het
Zfp1001	T	C	2: 150,204,972 (GRCm39)		probably benign	Het
Zfp780b	T	A	7: 27,664,252 (GRCm39)	N101I	probably damaging	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,705,888 (GRCm39)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,771,574 (GRCm39)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,761,353 (GRCm39)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,745,386 (GRCm39)	missense	probably benign
IGL01346:Ubr1	APN	2	120,703,603 (GRCm39)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,771,612 (GRCm39)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,756,494 (GRCm39)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,764,823 (GRCm39)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,705,879 (GRCm39)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,751,867 (GRCm39)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,730,989 (GRCm39)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,776,830 (GRCm39)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,694,854 (GRCm39)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,701,460 (GRCm39)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,771,472 (GRCm39)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,745,364 (GRCm39)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,771,572 (GRCm39)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,711,664 (GRCm39)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,791,637 (GRCm39)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,694,898 (GRCm39)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,725,641 (GRCm39)	missense	probably benign
I1329:Ubr1	UTSW	2	120,764,775 (GRCm39)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,791,654 (GRCm39)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,734,584 (GRCm39)	splice site	probably null
R0373:Ubr1	UTSW	2	120,777,138 (GRCm39)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,737,427 (GRCm39)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,711,574 (GRCm39)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,778,364 (GRCm39)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,711,582 (GRCm39)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,756,510 (GRCm39)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,786,125 (GRCm39)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,791,579 (GRCm39)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,765,800 (GRCm39)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,776,754 (GRCm39)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,773,034 (GRCm39)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,694,811 (GRCm39)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,756,528 (GRCm39)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,739,963 (GRCm39)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,793,929 (GRCm39)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,746,951 (GRCm39)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,693,168 (GRCm39)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4173:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4174:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4241:Ubr1	UTSW	2	120,764,867 (GRCm39)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,725,547 (GRCm39)	splice site	probably null
R4449:Ubr1	UTSW	2	120,776,862 (GRCm39)	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120,772,963 (GRCm39)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,756,494 (GRCm39)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,793,923 (GRCm39)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,745,419 (GRCm39)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,794,047 (GRCm39)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,742,478 (GRCm39)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,793,903 (GRCm39)	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120,712,745 (GRCm39)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,723,651 (GRCm39)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,734,525 (GRCm39)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,793,981 (GRCm39)	missense	probably benign
R5452:Ubr1	UTSW	2	120,698,783 (GRCm39)	missense	possibly damaging	0.95
R5610:Ubr1	UTSW	2	120,722,593 (GRCm39)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,793,998 (GRCm39)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,791,573 (GRCm39)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,734,486 (GRCm39)	missense	probably benign
R5979:Ubr1	UTSW	2	120,776,863 (GRCm39)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,723,690 (GRCm39)	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120,737,376 (GRCm39)	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120,711,520 (GRCm39)	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120,745,880 (GRCm39)	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120,754,611 (GRCm39)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,786,121 (GRCm39)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,727,156 (GRCm39)	splice site	probably null
R6994:Ubr1	UTSW	2	120,794,074 (GRCm39)	missense	probably benign
R7121:Ubr1	UTSW	2	120,705,979 (GRCm39)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,734,558 (GRCm39)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,693,246 (GRCm39)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,693,161 (GRCm39)	missense	probably benign
R7457:Ubr1	UTSW	2	120,748,309 (GRCm39)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,720,255 (GRCm39)	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120,705,925 (GRCm39)	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120,703,672 (GRCm39)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,764,855 (GRCm39)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,764,898 (GRCm39)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,791,585 (GRCm39)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,793,937 (GRCm39)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,741,596 (GRCm39)	missense	probably benign
R8293:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,701,476 (GRCm39)	missense	probably benign
R8489:Ubr1	UTSW	2	120,711,548 (GRCm39)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,696,964 (GRCm39)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,734,523 (GRCm39)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,697,034 (GRCm39)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,756,469 (GRCm39)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,754,615 (GRCm39)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,703,603 (GRCm39)	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120,778,325 (GRCm39)	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120,727,000 (GRCm39)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,765,765 (GRCm39)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,734,506 (GRCm39)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,703,627 (GRCm39)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,764,820 (GRCm39)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,732,092 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTCTCACTCATGTTGGAC -3'
(R):5'- AACAGAGGCTAAGTTCTGAATTCTC -3'

Sequencing Primer
(F):5'- GCTCTCACTCATGTTGGACACATC -3'
(R):5'- GTGGTGCCTTCTCTAAGACAAC -3'

Posted On

2016-10-26