Incidental Mutation 'R5583:Per1'
ID438580
Institutional Source Beutler Lab
Gene Symbol Per1
Ensembl Gene ENSMUSG00000020893
Gene Nameperiod circadian clock 1
SynonymsmPer1, m-rigui
MMRRC Submission 043137-MU
Accession Numbers

Genbank: NM_011065; MGI:1098283

Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R5583 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69095217-69109960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69103445 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 494 (H494R)
Ref Sequence ENSEMBL: ENSMUSP00000121713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021271] [ENSMUST00000101004] [ENSMUST00000102605] [ENSMUST00000132462] [ENSMUST00000142392] [ENSMUST00000166748]
Predicted Effect probably benign
Transcript: ENSMUST00000021271
AA Change: H494R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021271
Gene: ENSMUSG00000020893
AA Change: H494R

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1222 1.5e-78 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101004
AA Change: H494R

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098566
Gene: ENSMUSG00000020893
AA Change: H494R

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102605
AA Change: H474R

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099665
Gene: ENSMUSG00000020893
AA Change: H474R

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Blast:PAS 203 255 1e-23 BLAST
PAS 328 394 1.12e-4 SMART
PAC 402 445 1.6e0 SMART
low complexity region 453 461 N/A INTRINSIC
low complexity region 493 523 N/A INTRINSIC
low complexity region 551 558 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 727 752 N/A INTRINSIC
low complexity region 774 788 N/A INTRINSIC
low complexity region 797 824 N/A INTRINSIC
low complexity region 832 857 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
low complexity region 925 952 N/A INTRINSIC
low complexity region 976 993 N/A INTRINSIC
Pfam:Period_C 1011 1210 7.5e-75 PFAM
low complexity region 1250 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132462
SMART Domains Protein: ENSMUSP00000122164
Gene: ENSMUSG00000020893

DomainStartEndE-ValueType
low complexity region 48 81 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142392
AA Change: H494R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121713
Gene: ENSMUSG00000020893
AA Change: H494R

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166748
AA Change: H494R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132635
Gene: ENSMUSG00000020893
AA Change: H494R

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1230 5.2e-75 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display a persistent circadian rhythm, but they have a shorter period and their ability to maintain the precision and the stability of the period is impaired. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(3) Gene trapped(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,826 C710Y probably damaging Het
A1bg A T 15: 60,921,234 L8Q probably damaging Het
Abca4 T C 3: 122,148,901 V1681A probably damaging Het
Abce1 G T 8: 79,690,293 A363E probably benign Het
Adgrl2 T C 3: 148,859,164 Y256C probably damaging Het
Afm T C 5: 90,547,881 C416R probably damaging Het
Ahnak T A 19: 9,006,917 V1855D probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Ankrd35 G T 3: 96,684,903 R835L probably damaging Het
Atg2b T C 12: 105,649,155 D1014G possibly damaging Het
Cdk6 T A 5: 3,344,436 Y24N probably damaging Het
Chd7 T A 4: 8,752,473 N323K probably damaging Het
Cops9 A T 1: 92,639,767 probably benign Het
Crybg1 T C 10: 44,003,510 T561A probably benign Het
Dcdc5 T C 2: 106,365,433 noncoding transcript Het
Dnah7b G T 1: 46,242,199 A2807S probably benign Het
Fam149b A G 14: 20,363,300 T196A possibly damaging Het
Fam217a C A 13: 34,910,297 C402F probably damaging Het
Fat2 A T 11: 55,253,889 V4053E probably benign Het
Fcgbp T C 7: 28,091,579 V755A probably damaging Het
Fxr1 C A 3: 34,068,976 S641R probably benign Het
Gata5 A T 2: 180,334,254 M39K probably benign Het
Gon4l T A 3: 88,899,971 D1658E probably damaging Het
Gpr180 C T 14: 118,162,698 T426M probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Helq T C 5: 100,762,593 E1039G probably damaging Het
Hibch T A 1: 52,901,247 Y192N probably damaging Het
Hp1bp3 A G 4: 138,222,115 I41M probably damaging Het
Itpripl2 G T 7: 118,489,878 P486Q probably benign Het
Kcnj6 T C 16: 94,833,201 D17G probably benign Het
Kprp T A 3: 92,824,336 Y469F unknown Het
Kremen2 T C 17: 23,742,255 T373A probably benign Het
Lgi4 A G 7: 31,061,137 Y39C possibly damaging Het
Lgr5 T C 10: 115,478,504 D176G probably benign Het
Lrp1 T C 10: 127,588,463 S785G probably benign Het
Ltbp1 A T 17: 75,291,330 Q920L probably benign Het
Map2 A G 1: 66,416,037 E1362G probably damaging Het
Nkx2-6 T C 14: 69,171,823 S8P probably damaging Het
Olfr93 T C 17: 37,151,594 Q126R probably benign Het
Pde4dip C T 3: 97,747,576 R888Q possibly damaging Het
Pira2 A G 7: 3,842,546 F280L probably benign Het
Plekhm3 C T 1: 64,937,986 W108* probably null Het
Ptcd3 A G 6: 71,902,936 S113P probably damaging Het
Scarf1 T C 11: 75,514,016 L42P possibly damaging Het
Skint1 A C 4: 112,019,056 Q58P probably damaging Het
Spata7 A T 12: 98,669,331 N438I probably damaging Het
Spdya C A 17: 71,569,131 D164E probably damaging Het
Speer3 G A 5: 13,794,768 probably null Het
Ssc4d A T 5: 135,970,196 L51H probably damaging Het
Steap1 A G 5: 5,740,579 I123T possibly damaging Het
Styx T A 14: 45,371,026 F147I possibly damaging Het
Suv39h2 T A 2: 3,474,853 probably benign Het
Tfb2m A G 1: 179,545,881 V84A probably benign Het
Tlcd1 T G 11: 78,178,936 V25G probably benign Het
Tmem79 T C 3: 88,332,563 Y280C probably damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Ttc17 A T 2: 94,377,682 D194E probably damaging Het
Zfp2 T C 11: 50,900,157 E353G possibly damaging Het
Other mutations in Per1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Per1 APN 11 69104199 missense probably damaging 1.00
IGL01907:Per1 APN 11 69105599 missense probably benign 0.00
IGL02078:Per1 APN 11 69104299 missense probably damaging 1.00
IGL02296:Per1 APN 11 69102175 missense probably damaging 1.00
IGL02677:Per1 APN 11 69106660 missense probably benign 0.07
0152:Per1 UTSW 11 69104022 splice site probably benign
IGL03048:Per1 UTSW 11 69104726 missense probably damaging 0.99
P0043:Per1 UTSW 11 69102043 splice site probably benign
R0089:Per1 UTSW 11 69104043 missense probably benign 0.27
R0116:Per1 UTSW 11 69101880 splice site probably benign
R0395:Per1 UTSW 11 69102277 missense probably damaging 1.00
R0531:Per1 UTSW 11 69104190 missense probably damaging 1.00
R0681:Per1 UTSW 11 69101201 missense probably damaging 1.00
R0788:Per1 UTSW 11 69101359 splice site probably benign
R1233:Per1 UTSW 11 69102211 missense probably damaging 1.00
R1554:Per1 UTSW 11 69103627 missense probably damaging 1.00
R3793:Per1 UTSW 11 69109301 missense probably benign 0.30
R4706:Per1 UTSW 11 69100618 start gained probably benign
R4716:Per1 UTSW 11 69101231 missense probably damaging 1.00
R4965:Per1 UTSW 11 69104401 missense probably benign 0.06
R5111:Per1 UTSW 11 69100786 missense probably damaging 1.00
R5270:Per1 UTSW 11 69103598 missense probably benign
R5588:Per1 UTSW 11 69107627 missense probably damaging 1.00
R6184:Per1 UTSW 11 69102904 missense probably damaging 1.00
R6430:Per1 UTSW 11 69104296 missense probably damaging 1.00
R6819:Per1 UTSW 11 69101458 missense probably damaging 1.00
R6911:Per1 UTSW 11 69103257 missense probably damaging 1.00
X0023:Per1 UTSW 11 69103124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAAAGTGCGCACGTAAGG -3'
(R):5'- ATTGCTATCACTGGAGGAGC -3'

Sequencing Primer
(F):5'- ACGTAAGGGAACTGTGTCTCCAC -3'
(R):5'- CCAGGGCTGTGTAGAGGAC -3'
Posted On2016-10-26