Incidental Mutation 'R5586:Nr2e3'
ID438724
Institutional Source Beutler Lab
Gene Symbol Nr2e3
Ensembl Gene ENSMUSG00000032292
Gene Namenuclear receptor subfamily 2, group E, member 3
SynonymsRNR, photoreceptor-specific nuclear receptor, Pnr
MMRRC Submission 043140-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5586 (G1)
Quality Score147
Status Validated
Chromosome9
Chromosomal Location59942771-59960659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59949201 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 69 (R69G)
Ref Sequence ENSEMBL: ENSMUSP00000034831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034831]
Predicted Effect probably damaging
Transcript: ENSMUST00000034831
AA Change: R69G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034831
Gene: ENSMUSG00000032292
AA Change: R69G

DomainStartEndE-ValueType
ZnF_C4 37 109 1.26e-32 SMART
HOLI 209 367 3.92e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156845
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit rossettes and a reduced number of nuclei in the retinal outer nuclear layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Nr2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Nr2e3 APN 9 59949008 missense probably benign 0.14
R1448:Nr2e3 UTSW 9 59943514 missense probably damaging 1.00
R1521:Nr2e3 UTSW 9 59949205 missense probably damaging 0.99
R1657:Nr2e3 UTSW 9 59948767 missense probably benign 0.08
R1819:Nr2e3 UTSW 9 59943437 missense probably damaging 1.00
R1953:Nr2e3 UTSW 9 59949796 missense probably benign 0.23
R3919:Nr2e3 UTSW 9 59943440 missense probably damaging 1.00
R3925:Nr2e3 UTSW 9 59948433 missense probably damaging 1.00
R4654:Nr2e3 UTSW 9 59949072 intron probably benign
R5239:Nr2e3 UTSW 9 59949776 splice site probably benign
R5310:Nr2e3 UTSW 9 59949334 intron probably benign
R5811:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5812:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5813:Nr2e3 UTSW 9 59943418 small deletion probably benign
R7267:Nr2e3 UTSW 9 59948689 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCTTATCCACTGGGCACATC -3'
(R):5'- CAGATCTAGTTTGAGGAACGTGG -3'

Sequencing Primer
(F):5'- ACTTGGCACCTGCAGAGGAC -3'
(R):5'- TCTAGTTTGAGGAACGTGGGAACC -3'
Posted On2016-10-26