Incidental Mutation 'R5587:Dnah10'
ID438809
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Namedynein, axonemal, heavy chain 10
SynonymsDnahc10
MMRRC Submission 043141-MU
Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124725085-124834308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124793913 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2368 (L2368P)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: L2425P

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: L2425P

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126998
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: L2368P

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: L2368P

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124828603 missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124746616 missense probably benign 0.01
IGL00471:Dnah10 APN 5 124794341 missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124775512 missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124777212 missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124779154 missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124783946 missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124821341 missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124732489 missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124803328 missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124787465 missense probably benign 0.10
IGL01757:Dnah10 APN 5 124768927 missense probably benign 0.37
IGL01759:Dnah10 APN 5 124755786 missense probably benign
IGL01767:Dnah10 APN 5 124743737 splice site probably benign
IGL01769:Dnah10 APN 5 124764944 missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124783921 missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124789812 missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124804746 missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124819366 missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124833423 critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124773067 missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124773819 missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124789796 missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124793852 missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124821287 missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124787331 missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124799005 missense probably benign 0.26
IGL02709:Dnah10 APN 5 124773745 nonsense probably null
IGL02740:Dnah10 APN 5 124826863 splice site probably benign
IGL02746:Dnah10 APN 5 124730086 missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124798014 missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124801822 missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124763133 missense probably benign 0.07
IGL03076:Dnah10 APN 5 124730162 critical splice donor site probably null
IGL03109:Dnah10 APN 5 124764886 missense probably benign 0.10
IGL03181:Dnah10 APN 5 124748457 missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124817643 missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124817697 missense probably benign 0.00
IGL03328:Dnah10 APN 5 124754290 missense probably benign 0.06
frosty UTSW 5 124828137 missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124829529 missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124730100 missense probably benign
P0019:Dnah10 UTSW 5 124763066 missense probably benign
P0037:Dnah10 UTSW 5 124817992 nonsense probably null
PIT4366001:Dnah10 UTSW 5 124775524 missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124726902 missense probably benign
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124830744 missense probably benign 0.00
R0066:Dnah10 UTSW 5 124763076 missense probably benign 0.01
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124834075 missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124796369 splice site probably benign
R0321:Dnah10 UTSW 5 124823352 missense probably benign 0.29
R0410:Dnah10 UTSW 5 124755735 missense probably benign
R0480:Dnah10 UTSW 5 124808851 missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124812723 critical splice donor site probably null
R0533:Dnah10 UTSW 5 124775250 splice site probably null
R0599:Dnah10 UTSW 5 124800953 missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124750812 missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124829577 missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124797938 missense probably benign 0.00
R1203:Dnah10 UTSW 5 124760014 splice site probably null
R1248:Dnah10 UTSW 5 124755823 splice site probably benign
R1366:Dnah10 UTSW 5 124753326 missense probably benign 0.41
R1434:Dnah10 UTSW 5 124774986 missense probably benign 0.03
R1436:Dnah10 UTSW 5 124762221 missense probably benign 0.00
R1438:Dnah10 UTSW 5 124798945 missense probably benign 0.25
R1446:Dnah10 UTSW 5 124789796 missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124743686 missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1479:Dnah10 UTSW 5 124777889 missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124754239 missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124760952 missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124829614 missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124765562 missense probably benign 0.00
R1709:Dnah10 UTSW 5 124760091 missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124773190 intron probably null
R1828:Dnah10 UTSW 5 124761279 missense probably benign 0.00
R1854:Dnah10 UTSW 5 124804689 missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124832526 unclassified probably null
R1893:Dnah10 UTSW 5 124754317 missense probably benign 0.13
R1895:Dnah10 UTSW 5 124758430 missense probably benign 0.00
R1906:Dnah10 UTSW 5 124800984 missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124782268 missense probably benign 0.00
R1965:Dnah10 UTSW 5 124775203 missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124833988 missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124829587 missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124746704 missense probably benign 0.30
R2046:Dnah10 UTSW 5 124796341 missense probably benign 0.25
R2074:Dnah10 UTSW 5 124814674 missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124774981 missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124761237 missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124731466 missense probably benign 0.00
R2293:Dnah10 UTSW 5 124819221 missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124742000 missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124762865 critical splice donor site probably null
R2571:Dnah10 UTSW 5 124775478 missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124817670 missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124819412 critical splice donor site probably null
R3439:Dnah10 UTSW 5 124796258 missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124747630 missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124773031 missense probably benign 0.37
R4015:Dnah10 UTSW 5 124777926 missense probably benign 0.25
R4261:Dnah10 UTSW 5 124730137 missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124732330 missense probably benign 0.28
R4299:Dnah10 UTSW 5 124819925 missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124762869 splice site probably null
R4651:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4652:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4664:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124775517 missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124747745 missense probably benign 0.01
R4806:Dnah10 UTSW 5 124819344 missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124773132 missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124817748 missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124762196 missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124832513 missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5119:Dnah10 UTSW 5 124779258 missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124798960 missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124787420 missense probably benign 0.00
R5262:Dnah10 UTSW 5 124785156 missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124828137 missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124791787 missense probably benign 0.01
R5322:Dnah10 UTSW 5 124773566 missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124743629 missense probably benign 0.16
R5468:Dnah10 UTSW 5 124830493 missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124753168 missense probably benign
R5724:Dnah10 UTSW 5 124742026 missense probably benign 0.27
R5797:Dnah10 UTSW 5 124821386 missense probably benign 0.00
R5812:Dnah10 UTSW 5 124747746 missense probably benign 0.01
R5846:Dnah10 UTSW 5 124823373 missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R5961:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5970:Dnah10 UTSW 5 124808729 missense probably benign
R6021:Dnah10 UTSW 5 124736984 missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124801860 missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124819210 missense probably benign 0.09
R6080:Dnah10 UTSW 5 124805897 missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124753174 missense probably benign 0.18
R6155:Dnah10 UTSW 5 124770599 missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124785175 missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124823318 missense probably benign 0.02
R6238:Dnah10 UTSW 5 124743679 missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124794219 splice site probably null
R6275:Dnah10 UTSW 5 124785184 missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124775080 missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124829646 missense probably benign 0.00
R6458:Dnah10 UTSW 5 124809269 missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124762782 missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124758355 missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124830033 missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124760159 missense probably benign 0.45
R6702:Dnah10 UTSW 5 124805805 missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124808812 missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124777826 missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124790000 intron probably null
R6932:Dnah10 UTSW 5 124821450 missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124787426 missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124816142 missense probably benign 0.37
R7138:Dnah10 UTSW 5 124822945 missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124822942 missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124813828 missense probably benign 0.19
R7284:Dnah10 UTSW 5 124832598 missense probably benign 0.37
R7322:Dnah10 UTSW 5 124821269 missense probably benign 0.08
T0975:Dnah10 UTSW 5 124763066 missense probably benign
U24488:Dnah10 UTSW 5 124813980 missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124765697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCTTCTCAGGACATGACAAAC -3'
(R):5'- CACCTATAGCCGCCATATTGG -3'

Sequencing Primer
(F):5'- TCTCAGGACATGACAAACCTCTGATG -3'
(R):5'- CGCCATATTGGTTCAGACACATGG -3'
Posted On2016-10-26