Incidental Mutation 'R5587:Olfr617'
ID438819
Institutional Source Beutler Lab
Gene Symbol Olfr617
Ensembl Gene ENSMUSG00000073946
Gene Nameolfactory receptor 617
SynonymsGA_x6K02T2PBJ9-6306819-6307775, MOR31-10
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103573061-103586795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103584531 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 170 (Y170N)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
Predicted Effect probably benign
Transcript: ENSMUST00000048265
AA Change: Y170N

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: Y170N

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179692
Predicted Effect probably benign
Transcript: ENSMUST00000215755
AA Change: Y170N

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216516
AA Change: Y170N

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Olfr617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr617 APN 7 103584693 missense probably damaging 1.00
IGL01355:Olfr617 APN 7 103584373 missense probably damaging 1.00
IGL01411:Olfr617 APN 7 103584117 missense probably damaging 1.00
IGL01412:Olfr617 APN 7 103584907 missense probably damaging 1.00
IGL02379:Olfr617 APN 7 103584892 missense possibly damaging 0.84
ANU23:Olfr617 UTSW 7 103584693 missense probably damaging 1.00
IGL03054:Olfr617 UTSW 7 103584840 missense probably benign 0.23
R0536:Olfr617 UTSW 7 103584261 missense probably damaging 1.00
R4222:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R4224:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R5342:Olfr617 UTSW 7 103584828 missense probably benign 0.05
R5607:Olfr617 UTSW 7 103584299 nonsense probably null
R5608:Olfr617 UTSW 7 103584299 nonsense probably null
R6904:Olfr617 UTSW 7 103584520 missense possibly damaging 0.83
R6929:Olfr617 UTSW 7 103584444 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTTCATATTTGTGGCAGAGTCTG -3'
(R):5'- TACCTAGAGCCTTGAGTCGG -3'

Sequencing Primer
(F):5'- AGAGTCTGCCATACTGCTAGCTATG -3'
(R):5'- CTTGAGTCGGGCATCTCGAGAAG -3'
Posted On2016-10-26