Incidental Mutation 'R5587:Adamts18'
ID438822
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
SynonymsE130314N14Rik
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5587 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location113697126-113848738 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 113775360 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 290 (Q290*)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
Predicted Effect probably null
Transcript: ENSMUST00000093113
AA Change: Q290*
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: Q290*

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212527
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213078
Meta Mutation Damage Score 0.696 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bcl3 A T 7: 19,809,634 Y10* probably null Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 113774943 missense probably damaging 1.00
IGL01548:Adamts18 APN 8 113764299 missense probably damaging 1.00
IGL01556:Adamts18 APN 8 113845109 missense probably benign 0.01
IGL01833:Adamts18 APN 8 113743096 missense probably benign 0.10
IGL02187:Adamts18 APN 8 113713194 missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 113699072 missense probably damaging 1.00
IGL02756:Adamts18 APN 8 113714344 splice site probably benign
IGL03188:Adamts18 APN 8 113699024 missense probably damaging 1.00
IGL03411:Adamts18 APN 8 113764297 nonsense probably null
R0119:Adamts18 UTSW 8 113774953 missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 113743117 missense probably damaging 1.00
R0410:Adamts18 UTSW 8 113714358 nonsense probably null
R0480:Adamts18 UTSW 8 113738818 missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 113738769 intron probably null
R0924:Adamts18 UTSW 8 113705396 splice site probably null
R0930:Adamts18 UTSW 8 113705396 splice site probably null
R1333:Adamts18 UTSW 8 113705173 splice site probably benign
R1441:Adamts18 UTSW 8 113754562 critical splice donor site probably null
R2082:Adamts18 UTSW 8 113775333 missense probably damaging 1.00
R2146:Adamts18 UTSW 8 113845003 missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 113705261 missense probably benign 0.36
R3148:Adamts18 UTSW 8 113738858 missense probably damaging 1.00
R3963:Adamts18 UTSW 8 113777811 missense probably benign 0.00
R4056:Adamts18 UTSW 8 113737580 nonsense probably null
R4486:Adamts18 UTSW 8 113713193 missense probably benign 0.00
R4608:Adamts18 UTSW 8 113737613 missense probably damaging 1.00
R4624:Adamts18 UTSW 8 113773168 nonsense probably null
R4626:Adamts18 UTSW 8 113773168 nonsense probably null
R4627:Adamts18 UTSW 8 113773168 nonsense probably null
R4628:Adamts18 UTSW 8 113773168 nonsense probably null
R4629:Adamts18 UTSW 8 113773168 nonsense probably null
R4710:Adamts18 UTSW 8 113706926 missense probably damaging 0.98
R4959:Adamts18 UTSW 8 113736725 nonsense probably null
R4973:Adamts18 UTSW 8 113736725 nonsense probably null
R4976:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5119:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5141:Adamts18 UTSW 8 113775270 missense probably damaging 1.00
R5422:Adamts18 UTSW 8 113698974 missense probably benign 0.06
R5868:Adamts18 UTSW 8 113777748 missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 113773077 missense probably damaging 1.00
R5906:Adamts18 UTSW 8 113709619 missense probably benign 0.00
R5942:Adamts18 UTSW 8 113777748 missense probably benign 0.01
R6006:Adamts18 UTSW 8 113706974 missense probably damaging 1.00
R6608:Adamts18 UTSW 8 113775279 missense probably damaging 1.00
R6725:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R7002:Adamts18 UTSW 8 113775290 missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 113775264 missense probably damaging 0.99
R7292:Adamts18 UTSW 8 113709645 missense probably benign 0.00
Z1088:Adamts18 UTSW 8 113775440 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCATTTCATCCATACCAGGAAATC -3'
(R):5'- AAATCTCAGGTGCAAAGCCC -3'

Sequencing Primer
(F):5'- ACCAGGAAATCTTTGTCTTAGGG -3'
(R):5'- CCAGGGCAGGTGACAAC -3'
Posted On2016-10-26