Incidental Mutation 'R5588:Gapvd1'
ID438864
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.620) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34709154 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 690 (T690S)
Ref Sequence ENSEMBL: ENSMUSP00000099864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]
Predicted Effect probably damaging
Transcript: ENSMUST00000028224
AA Change: T690S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: T690S

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102800
AA Change: T690S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: T690S

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113099
AA Change: T711S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: T711S

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113101
SMART Domains Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
VPS9 443 548 1.08e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113103
AA Change: T547S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867
AA Change: T547S

DomainStartEndE-ValueType
Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113111
AA Change: T148S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867
AA Change: T148S

DomainStartEndE-ValueType
internal_repeat_1 85 114 3.65e-6 PROSPERO
low complexity region 123 137 N/A INTRINSIC
internal_repeat_1 145 176 3.65e-6 PROSPERO
low complexity region 334 349 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 431 441 N/A INTRINSIC
VPS9 791 896 1.08e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128855
AA Change: T51S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129138
Gene: ENSMUSG00000026867
AA Change: T51S

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137528
AA Change: T573S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867
AA Change: T573S

DomainStartEndE-ValueType
Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167251
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Kif5b T G 18: 6,225,787 N160T probably benign Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 unclassified probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACTGTCTGATATTGGCCTTATC -3'
(R):5'- AGCCACTTTCCCGTGTTAAGAG -3'

Sequencing Primer
(F):5'- TTTAAGTTCAAAGTCAGCCAGGGC -3'
(R):5'- CCCGTGTTAAGAGTCTCTCTC -3'
Posted On2016-10-26