Incidental Mutation 'R5588:Kif5b'
ID438923
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Namekinesin family member 5B
Synonymskinesin heavy chain, Khc
MMRRC Submission 043268-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5588 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location6201002-6242174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6225787 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 160 (N160T)
Ref Sequence ENSEMBL: ENSMUSP00000025083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
Predicted Effect probably benign
Transcript: ENSMUST00000025083
AA Change: N160T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: N160T

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163210
AA Change: N160T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740
AA Change: N160T

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168187
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,275 Q518* probably null Het
4930407I10Rik C A 15: 82,065,216 Q1105K possibly damaging Het
A430078G23Rik T A 8: 3,388,878 probably benign Het
Afg3l2 A T 18: 67,440,207 V175D possibly damaging Het
Aldh1a2 G A 9: 71,283,450 R325H probably damaging Het
Atp8a1 A G 5: 67,814,684 L43P probably damaging Het
Bdh1 T C 16: 31,438,119 probably null Het
Ccdc85c T C 12: 108,211,534 Y320C probably damaging Het
Cobl A T 11: 12,343,886 L290* probably null Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Dhx34 T C 7: 16,198,900 H1038R probably damaging Het
Eea1 T C 10: 96,023,910 V686A probably benign Het
Eif2b4 A T 5: 31,192,173 C101* probably null Het
Eif4a3 A C 11: 119,296,126 S84A probably benign Het
Elfn2 T C 15: 78,673,876 D157G probably damaging Het
Fam198a C T 9: 121,965,181 Q134* probably null Het
Fat2 T A 11: 55,282,277 I2537F probably damaging Het
Fbxo38 A G 18: 62,526,177 F350L probably damaging Het
Fgd3 A T 13: 49,287,310 L215Q probably damaging Het
Fhdc1 A G 3: 84,465,476 V73A possibly damaging Het
Gapvd1 T A 2: 34,709,154 T690S probably damaging Het
Gm14418 A T 2: 177,387,272 I310K probably benign Het
Gm5141 A T 13: 62,773,770 N528K probably benign Het
Gsap A C 5: 21,251,149 E417A probably damaging Het
Kcnab1 A C 3: 65,376,555 D398A possibly damaging Het
Lilr4b G A 10: 51,481,326 R86Q probably benign Het
Lmo7 T C 14: 101,896,590 probably null Het
Mlph T C 1: 90,931,599 S219P possibly damaging Het
Ncapg2 T C 12: 116,413,077 I95T possibly damaging Het
Nedd9 A T 13: 41,315,961 I572N possibly damaging Het
Nup155 G A 15: 8,119,253 probably null Het
Olfml2a T C 2: 38,960,035 S588P probably damaging Het
Olfr1240 T C 2: 89,439,416 R288G probably damaging Het
Olfr1259 T A 2: 89,943,792 T108S probably benign Het
Olfr802 T G 10: 129,681,836 N301T possibly damaging Het
Parva C A 7: 112,560,062 N142K possibly damaging Het
Pclo T A 5: 14,788,398 S4678R unknown Het
Pcnt T C 10: 76,442,611 D3G possibly damaging Het
Pdzd2 A C 15: 12,374,281 S1923A possibly damaging Het
Per1 G A 11: 69,107,627 G1055D probably damaging Het
Plb1 G A 5: 32,329,949 probably null Het
Ppp1r14a C T 7: 29,293,284 P137L probably damaging Het
Rfx2 A T 17: 56,779,890 S612T possibly damaging Het
Rtel1 T C 2: 181,352,100 F642L probably benign Het
Sec14l3 T C 11: 4,066,138 F19S probably damaging Het
Skint8 A T 4: 111,936,892 M160L probably benign Het
Slc19a3 G T 1: 83,023,055 Y80* probably null Het
Slc37a1 T A 17: 31,346,457 W489R probably damaging Het
Smc4 A G 3: 69,025,857 I604V probably benign Het
Srprb G T 9: 103,198,849 Y796* probably null Het
Tdrd7 T A 4: 45,992,225 S220T probably benign Het
Tex15 T C 8: 33,577,187 F2215S probably damaging Het
Ticrr C T 7: 79,679,105 A664V probably damaging Het
Tnc T G 4: 64,006,422 D1013A possibly damaging Het
Tpte T A 8: 22,284,967 Y18N possibly damaging Het
Ubqlnl T A 7: 104,149,132 Q386L probably damaging Het
Vmn1r194 T C 13: 22,244,342 V43A possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r-ps130 A T 17: 23,063,829 Q161L probably benign Het
Zfhx4 T G 3: 5,403,138 D2785E probably damaging Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R2091:Kif5b UTSW 18 6213248 nonsense probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5260:Kif5b UTSW 18 6211058 missense probably damaging 1.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5621:Kif5b UTSW 18 6226883 missense probably benign 0.41
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6377:Kif5b UTSW 18 6212562 missense probably damaging 1.00
R6955:Kif5b UTSW 18 6211070 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCGACATGTCTGTTGGATTTCC -3'
(R):5'- AATGCATTGTCCTTCCCTTGGG -3'

Sequencing Primer
(F):5'- TGTTGGATTTCCCTTCATCTATGG -3'
(R):5'- GCTAAGGGAAACCTACCA -3'
Posted On2016-10-26