Incidental Mutation 'R5600:Fgfrl1'
ID438978
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Namefibroblast growth factor receptor-like 1
SynonymsFGFR5, FGFR5beta, FGFR5gamma, fibroblast growth factor receptor 5
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108692382-108706924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108705302 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 173 (C173R)
Ref Sequence ENSEMBL: ENSMUSP00000108179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
Predicted Effect probably damaging
Transcript: ENSMUST00000013633
AA Change: C264R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: C264R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112560
AA Change: C173R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090
AA Change: C173R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196222
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199802
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11b A C 15: 77,635,088 M264R probably damaging Het
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108705887 missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108705953 missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108705865 missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108704673 missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108706281 unclassified probably benign
R1967:Fgfrl1 UTSW 5 108705005 missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108705031 missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108706060 missense probably benign 0.13
R3605:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3606:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3767:Fgfrl1 UTSW 5 108705376 missense possibly damaging 0.78
R4603:Fgfrl1 UTSW 5 108703535 missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108703497 nonsense probably null
R6349:Fgfrl1 UTSW 5 108705506 missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108704972 nonsense probably null
R6679:Fgfrl1 UTSW 5 108704973 missense probably damaging 1.00
R7247:Fgfrl1 UTSW 5 108703499 missense possibly damaging 0.91
X0018:Fgfrl1 UTSW 5 108704974 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGCCACCTACAAAGTGGATG -3'
(R):5'- GCAGATGTACATGCCAGCATC -3'

Sequencing Primer
(F):5'- GCCACCTACAAAGTGGATGTAATC -3'
(R):5'- GATGTACATGCCAGCATCATCCTG -3'
Posted On2016-10-26